EMAIL THIS PAGE TO A FRIEND

MAEL

maelstrom spermatogenic transposon silencer

83 Gene Product Result for
Synonyms: CT128 RP11-102C16.1 SPATA35
UniProtKB ID: Q96JY0, B4DY43, Q49AP9, Q5VZP8, Q9UIW6
Gene ID:
Mouse(98558) maelstrom homolog (Drosophila)
Rat(364039) maelstrom spermatogenic transposon silencer
fruit fly(40489) maelstrom
chicken(418446) maelstrom homolog (Drosophila)
domestic cat(101097778) maelstrom homolog (Drosophila)
cow(541073) maelstrom homolog (Drosophila)
Horse(100051291) maelstrom homolog (Drosophila)
dog(490363) maelstrom homolog (Drosophila)
naked mole-rat(101713919) maelstrom spermatogenic transposon silencer
Domestic Rabbit(100355304) maelstrom homolog (Drosophila)
domestic guinea pig(100735091) maelstrom spermatogenic transposon silencer
sheep(101113811) maelstrom homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175296 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175296 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175296 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032858 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032858 Rosetta Predictions human pricing
NM_001108857 Rosetta Predictions rat pricing
NM_175296 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023410 predicted 1422
2 SASI_Hs01_00023411 predicted 1239
3 SASI_Hs01_00023415 predicted 1416
4 SASI_Hs02_00360454 predicted 1025
5 SASI_Hs02_00360455 predicted 934
6 SASI_Hs01_00023416 predicted 1166
7 SASI_Hs01_00023417 predicted 863
8 SASI_Hs01_00023418 predicted 1049
9 SASI_Hs01_00023419 predicted 632
10 SASI_Hs02_00360456 predicted 1452
11 SASI_Hs01_00023412 predicted 650
12 SASI_Hs01_00023413 predicted 750
13 SASI_Hs01_00023414 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242765 predicted 485
2 SASI_Rn02_00242766 predicted 1173
3 SASI_Rn02_00242767 predicted 1040
4 SASI_Rn02_00242768 predicted 962
5 SASI_Rn02_00242769 predicted 594
6 SASI_Rn02_00242770 predicted 992
7 SASI_Rn02_00242771 predicted 484
8 SASI_Rn02_00242772 predicted 546
9 SASI_Rn02_00242773 predicted 1129
10 SASI_Rn02_00242774 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040602 predicted 1161
2 SASI_Mm02_00346051 predicted 1033
3 SASI_Mm01_00040603 predicted 481
4 SASI_Mm01_00040604 predicted 1244
5 SASI_Mm01_00040606 predicted 483
6 SASI_Mm01_00040607 predicted 1138
7 SASI_Mm01_00040608 predicted 606
8 SASI_Mm01_00040609 predicted 598
9 SASI_Mm01_00040610 predicted 573
10 SASI_Mm01_00040611 predicted 1257
11 SASI_Mm01_00040605 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175296
MAEL MISSION shRNA Bacterial Glycerol Stock
maelstrom spermatogenic transposon silencer
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000084933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175296.3-1464s1c1
Sequence:CCGGCAATAGTAAATGTCACTCCTACTCGAGTAGGAGTGACATTTACTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175296.3-772s1c1
Sequence:CCGGCGGGCATCAGAAATAAGGCAACTCGAGTTGCCTTATTTCTGATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175296.3-569s1c1
Sequence:CCGGCACGAGGATTTCGATTCCATTCTCGAGAATGGAATCGAAATCCTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175296.3-1286s1c1
Sequence:CCGGCCTCCAACAACATCCATAGATCTCGAGATCTATGGATGTTGTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175296
MAEL MISSION shRNA shRNA Plasmid DNA
maelstrom spermatogenic transposon silencer
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000084933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175296.3-1464s1c1
Sequence:CCGGCAATAGTAAATGTCACTCCTACTCGAGTAGGAGTGACATTTACTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175296.3-772s1c1
Sequence:CCGGCGGGCATCAGAAATAAGGCAACTCGAGTTGCCTTATTTCTGATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175296.3-569s1c1
Sequence:CCGGCACGAGGATTTCGATTCCATTCTCGAGAATGGAATCGAAATCCTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175296.3-1286s1c1
Sequence:CCGGCCTCCAACAACATCCATAGATCTCGAGATCTATGGATGTTGTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175296
MAEL MISSION shRNA Lentiviral Transduction Particles
maelstrom spermatogenic transposon silencer
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000084933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175296.3-1464s1c1
Sequence:CCGGCAATAGTAAATGTCACTCCTACTCGAGTAGGAGTGACATTTACTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175296.3-772s1c1
Sequence:CCGGCGGGCATCAGAAATAAGGCAACTCGAGTTGCCTTATTTCTGATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175296.3-569s1c1
Sequence:CCGGCACGAGGATTTCGATTCCATTCTCGAGAATGGAATCGAAATCCTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175296.3-1286s1c1
Sequence:CCGGCCTCCAACAACATCCATAGATCTCGAGATCTATGGATGTTGTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032858
MAEL MISSION shRNA Bacterial Glycerol Stock
maelstrom spermatogenic transposon silencer
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-1252s1c1
Sequence:CCGGCCCGCTTACTAGAGAGCATTTCTCGAGAAATGCTCTCTAGTAAGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-1047s1c1
Sequence:CCGGCAAGATTATGAGGCCAGCAATCTCGAGATTGCTGGCCTCATAATCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-1139s1c1
Sequence:CCGGCTCTCATTTCAACTCTTCTAACTCGAGTTAGAAGAGTTGAAATGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-849s1c1
Sequence:CCGGGAGCCCTCTAAGACTTGGATTCTCGAGAATCCAAGTCTTAGAGGGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-561s1c1
Sequence:CCGGCCACGAGGATTTCGATTTCATCTCGAGATGAAATCGAAATCCTCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032858.1-1461s21c1
Sequence:CCGGGACAAATGTCACTACTATAAACTCGAGTTTATAGTAGTGACATTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032858.1-883s21c1
Sequence:CCGGATGTGGCCATGTGGGATTATTCTCGAGAATAATCCCACATGGCCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032858.1-710s21c1
Sequence:CCGGCTACTGCAAGTCTGATGATAGCTCGAGCTATCATCAGACTTGCAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032858.1-975s21c1
Sequence:CCGGATTGCGTACTGCATCAGTAATCTCGAGATTACTGATGCAGTACGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032858
MAEL MISSION shRNA shRNA Plasmid DNA
maelstrom spermatogenic transposon silencer
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-1252s1c1
Sequence:CCGGCCCGCTTACTAGAGAGCATTTCTCGAGAAATGCTCTCTAGTAAGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-1047s1c1
Sequence:CCGGCAAGATTATGAGGCCAGCAATCTCGAGATTGCTGGCCTCATAATCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-1139s1c1
Sequence:CCGGCTCTCATTTCAACTCTTCTAACTCGAGTTAGAAGAGTTGAAATGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-849s1c1
Sequence:CCGGGAGCCCTCTAAGACTTGGATTCTCGAGAATCCAAGTCTTAGAGGGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-561s1c1
Sequence:CCGGCCACGAGGATTTCGATTTCATCTCGAGATGAAATCGAAATCCTCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032858.1-1461s21c1
Sequence:CCGGGACAAATGTCACTACTATAAACTCGAGTTTATAGTAGTGACATTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032858.1-883s21c1
Sequence:CCGGATGTGGCCATGTGGGATTATTCTCGAGAATAATCCCACATGGCCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032858.1-710s21c1
Sequence:CCGGCTACTGCAAGTCTGATGATAGCTCGAGCTATCATCAGACTTGCAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032858.1-975s21c1
Sequence:CCGGATTGCGTACTGCATCAGTAATCTCGAGATTACTGATGCAGTACGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032858
MAEL MISSION shRNA Lentiviral Transduction Particles
maelstrom spermatogenic transposon silencer
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-1252s1c1
Sequence:CCGGCCCGCTTACTAGAGAGCATTTCTCGAGAAATGCTCTCTAGTAAGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-1047s1c1
Sequence:CCGGCAAGATTATGAGGCCAGCAATCTCGAGATTGCTGGCCTCATAATCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-1139s1c1
Sequence:CCGGCTCTCATTTCAACTCTTCTAACTCGAGTTAGAAGAGTTGAAATGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-849s1c1
Sequence:CCGGGAGCCCTCTAAGACTTGGATTCTCGAGAATCCAAGTCTTAGAGGGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032858.1-561s1c1
Sequence:CCGGCCACGAGGATTTCGATTTCATCTCGAGATGAAATCGAAATCCTCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032858.1-1461s21c1
Sequence:CCGGGACAAATGTCACTACTATAAACTCGAGTTTATAGTAGTGACATTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032858.1-883s21c1
Sequence:CCGGATGTGGCCATGTGGGATTATTCTCGAGAATAATCCCACATGGCCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032858.1-710s21c1
Sequence:CCGGCTACTGCAAGTCTGATGATAGCTCGAGCTATCATCAGACTTGCAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032858.1-975s21c1
Sequence:CCGGATTGCGTACTGCATCAGTAATCTCGAGATTACTGATGCAGTACGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)