EMAIL THIS PAGE TO A FRIEND

MAF1

MAF1 homolog (S. cerevisiae)

110 Gene Product Result for
UniProtKB ID: Q9H063, D3DWL4
Gene ID:
Human(84232) Summary: This gene encodes a protein that is similar to Maf1, a Saccharomyces cerevisiae protein highly conserved in eukaryotic cells. Yeast Maf1 is a negative effector of RNA polymerase III (Pol III). It responds to changes in the cellular environment and represses pol III transcription. Biochemical studies identified the initiation factor TFIIIB as a target for Maf1-dependent repression. [provided by RefSeq, Jul 2008]
Mouse(68877) MAF1 homolog (S. cerevisiae)
Rat(315093) MAF1 homolog (S. cerevisiae)
Zebrafish(406750) MAF1 homolog (S. cerevisiae)
cow(512498) MAF1 homolog (S. cerevisiae)
domestic cat(101101110) MAF1 homolog (S. cerevisiae)
dog(482087) MAF1 homolog (S. cerevisiae)
chicken(100857613) MAF1 homolog (S. cerevisiae)
fruit fly(3354925) CG40196 gene product from transcript CG40196-RB
Thale Cress(844042) agamous-like MADS-box protein AGL27
naked mole-rat(101699038) MAF1 homolog (S. cerevisiae)
domestic guinea pig(100713721) MAF1 homolog (S. cerevisiae)
sheep(101113157) MAF1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032272 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032272 Rosetta Predictions human pricing
NM_001014085 Rosetta Predictions rat pricing
NM_026859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135954 predicted 804
2 SASI_Hs01_00135956 predicted 990
3 SASI_Hs01_00135957 predicted 1401
4 SASI_Hs01_00135958 predicted 1542
5 SASI_Hs01_00135960 predicted 841
6 SASI_Hs01_00135961 predicted 860
7 SASI_Hs02_00359591 predicted 1139
8 SASI_Hs01_00135963 predicted 891
9 SASI_Hs02_00359592 predicted 994
10 SASI_Hs01_00135955 predicted 923
11 SASI_Hs01_00135959 predicted 1040
12 SASI_Hs01_00135962 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099804 predicted 933
2 SASI_Rn01_00099805 predicted 841
3 SASI_Rn01_00099806 predicted 844
4 SASI_Rn01_00099807 predicted 435
5 SASI_Rn01_00099808 predicted 937
6 SASI_Rn01_00099809 predicted 616
7 SASI_Rn01_00099810 predicted 583
8 SASI_Rn02_00201511 predicted 617
9 SASI_Rn02_00201512 predicted 899
10 SASI_Rn01_00099811 predicted 449
11 SASI_Rn01_00099812 predicted 608
12 SASI_Rn01_00099813 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031213 predicted 470
2 SASI_Mm01_00031214 predicted 892
3 SASI_Mm01_00031215 predicted 892
4 SASI_Mm01_00031216 predicted 494
5 SASI_Mm01_00031217 predicted 481
6 SASI_Mm01_00031218 predicted 986
7 SASI_Mm01_00031219 predicted 786
8 SASI_Mm01_00031220 predicted 1304
9 SASI_Mm01_00031221 predicted 738
10 SASI_Mm01_00031222 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026859
VALIDATED
MAF1 MISSION shRNA Bacterial Glycerol Stock
MAF1 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-950s1c1
Sequence:CCGGCCTCTGGTCATTCAACTATTTCTCGAGAAATAGTTGAATGACCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-679s1c1
Sequence:CCGGCCCTCTTCTATCTGATTGCCACTCGAGTGGCAATCAGATAGAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-1522s1c1
Sequence:CCGGGCCAGTAGTTTGAAGCCCTATCTCGAGATAGGGCTTCAAACTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-518s21c1
Sequence:CCGGTAAGATGGCGGGAGATGATAACTCGAGTTATCATCTCCCGCCATCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026859.3-903s21c1
Sequence:CCGGTGTGACATCTACAGCTATAACCTCGAGGTTATAGCTGTAGATGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026859.2-471s1c1
Sequence:CCGGGCCCATATTATTGGCAGGATTCTCGAGAATCCTGCCAATAATATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-459s1c1
Sequence:CCGGGAGACTGGAGATGCCCATATTCTCGAGAATATGGGCATCTCCAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-472s21c1
Sequence:CCGGAGACTGGAGATGCCCATATTACTCGAGTAATATGGGCATCTCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-1391s21c1
Sequence:CCGGCCATGCTGTGGCTGGATTAAACTCGAGTTTAATCCAGCCACAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-991s21c1
Sequence:CCGGATAAGAGACTGAAGCGAATTGCTCGAGCAATTCGCTTCAGTCTCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-1525s21c1
Sequence:CCGGGCTCTAAGGGCCAGTAGTTTGCTCGAGCAAACTACTGGCCCTTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026859
VALIDATED
MAF1 MISSION shRNA shRNA Plasmid DNA
MAF1 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-950s1c1
Sequence:CCGGCCTCTGGTCATTCAACTATTTCTCGAGAAATAGTTGAATGACCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-679s1c1
Sequence:CCGGCCCTCTTCTATCTGATTGCCACTCGAGTGGCAATCAGATAGAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-1522s1c1
Sequence:CCGGGCCAGTAGTTTGAAGCCCTATCTCGAGATAGGGCTTCAAACTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-518s21c1
Sequence:CCGGTAAGATGGCGGGAGATGATAACTCGAGTTATCATCTCCCGCCATCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026859.3-903s21c1
Sequence:CCGGTGTGACATCTACAGCTATAACCTCGAGGTTATAGCTGTAGATGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026859.2-471s1c1
Sequence:CCGGGCCCATATTATTGGCAGGATTCTCGAGAATCCTGCCAATAATATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-459s1c1
Sequence:CCGGGAGACTGGAGATGCCCATATTCTCGAGAATATGGGCATCTCCAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-472s21c1
Sequence:CCGGAGACTGGAGATGCCCATATTACTCGAGTAATATGGGCATCTCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-1391s21c1
Sequence:CCGGCCATGCTGTGGCTGGATTAAACTCGAGTTTAATCCAGCCACAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-991s21c1
Sequence:CCGGATAAGAGACTGAAGCGAATTGCTCGAGCAATTCGCTTCAGTCTCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-1525s21c1
Sequence:CCGGGCTCTAAGGGCCAGTAGTTTGCTCGAGCAAACTACTGGCCCTTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026859
VALIDATED
MAF1 MISSION shRNA Lentiviral Transduction Particles
MAF1 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-950s1c1
Sequence:CCGGCCTCTGGTCATTCAACTATTTCTCGAGAAATAGTTGAATGACCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-679s1c1
Sequence:CCGGCCCTCTTCTATCTGATTGCCACTCGAGTGGCAATCAGATAGAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-1522s1c1
Sequence:CCGGGCCAGTAGTTTGAAGCCCTATCTCGAGATAGGGCTTCAAACTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-518s21c1
Sequence:CCGGTAAGATGGCGGGAGATGATAACTCGAGTTATCATCTCCCGCCATCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026859.3-903s21c1
Sequence:CCGGTGTGACATCTACAGCTATAACCTCGAGGTTATAGCTGTAGATGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026859.2-471s1c1
Sequence:CCGGGCCCATATTATTGGCAGGATTCTCGAGAATCCTGCCAATAATATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026859.2-459s1c1
Sequence:CCGGGAGACTGGAGATGCCCATATTCTCGAGAATATGGGCATCTCCAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-472s21c1
Sequence:CCGGAGACTGGAGATGCCCATATTACTCGAGTAATATGGGCATCTCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-1391s21c1
Sequence:CCGGCCATGCTGTGGCTGGATTAAACTCGAGTTTAATCCAGCCACAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-991s21c1
Sequence:CCGGATAAGAGACTGAAGCGAATTGCTCGAGCAATTCGCTTCAGTCTCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026859.3-1525s21c1
Sequence:CCGGGCTCTAAGGGCCAGTAGTTTGCTCGAGCAAACTACTGGCCCTTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032272
VALIDATED
MAF1 MISSION shRNA Bacterial Glycerol Stock
MAF1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032272.4-1526s21c1
Sequence:CCGGCCCAAATGAACTGCCACAGCACTCGAGTGCTGTGGCAGTTCATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032272.4-1553s21c1
Sequence:CCGGGCTGGACCGCAGAGTTTATTTCTCGAGAAATAAACTCTGCGGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-520s1c1
Sequence:CCGGCAAACACATGTTCAAGCAGTTCTCGAGAACTGCTTGAACATGTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032272.2-484s1c1
Sequence:CCGGGATTGAGAGCTACTCATGTAACTCGAGTTACATGAGTAGCTCTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-982s1c1
Sequence:CCGGGCTCAAGCGAATCGTCTTCTTCTCGAGAAGAAGACGATTCGCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-480s1c1
Sequence:CCGGGCAGGATTGAGAGCTACTCATCTCGAGATGAGTAGCTCTCAATCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-670s1c1
Sequence:CCGGCAAGACCCTCTTCTACCTGATCTCGAGATCAGGTAGAAGAGGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-958s1c1
Sequence:CCGGCAACTACTTCTTCTACAACAACTCGAGTTGTTGTAGAAGAAGTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032272.4-923s21c1
Sequence:CCGGAGGACTTCAAGGATCTGAAACCTCGAGGTTTCAGATCCTTGAAGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032272
VALIDATED
MAF1 MISSION shRNA shRNA Plasmid DNA
MAF1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032272.4-1526s21c1
Sequence:CCGGCCCAAATGAACTGCCACAGCACTCGAGTGCTGTGGCAGTTCATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032272.4-1553s21c1
Sequence:CCGGGCTGGACCGCAGAGTTTATTTCTCGAGAAATAAACTCTGCGGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-520s1c1
Sequence:CCGGCAAACACATGTTCAAGCAGTTCTCGAGAACTGCTTGAACATGTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032272.2-484s1c1
Sequence:CCGGGATTGAGAGCTACTCATGTAACTCGAGTTACATGAGTAGCTCTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-982s1c1
Sequence:CCGGGCTCAAGCGAATCGTCTTCTTCTCGAGAAGAAGACGATTCGCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-480s1c1
Sequence:CCGGGCAGGATTGAGAGCTACTCATCTCGAGATGAGTAGCTCTCAATCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-670s1c1
Sequence:CCGGCAAGACCCTCTTCTACCTGATCTCGAGATCAGGTAGAAGAGGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-958s1c1
Sequence:CCGGCAACTACTTCTTCTACAACAACTCGAGTTGTTGTAGAAGAAGTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032272.4-923s21c1
Sequence:CCGGAGGACTTCAAGGATCTGAAACCTCGAGGTTTCAGATCCTTGAAGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032272
VALIDATED
MAF1 MISSION shRNA Lentiviral Transduction Particles
MAF1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032272.4-1526s21c1
Sequence:CCGGCCCAAATGAACTGCCACAGCACTCGAGTGCTGTGGCAGTTCATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032272.4-1553s21c1
Sequence:CCGGGCTGGACCGCAGAGTTTATTTCTCGAGAAATAAACTCTGCGGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-520s1c1
Sequence:CCGGCAAACACATGTTCAAGCAGTTCTCGAGAACTGCTTGAACATGTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032272.2-484s1c1
Sequence:CCGGGATTGAGAGCTACTCATGTAACTCGAGTTACATGAGTAGCTCTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-982s1c1
Sequence:CCGGGCTCAAGCGAATCGTCTTCTTCTCGAGAAGAAGACGATTCGCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-480s1c1
Sequence:CCGGGCAGGATTGAGAGCTACTCATCTCGAGATGAGTAGCTCTCAATCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-670s1c1
Sequence:CCGGCAAGACCCTCTTCTACCTGATCTCGAGATCAGGTAGAAGAGGGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032272.2-958s1c1
Sequence:CCGGCAACTACTTCTTCTACAACAACTCGAGTTGTTGTAGAAGAAGTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032272.4-923s21c1
Sequence:CCGGAGGACTTCAAGGATCTGAAACCTCGAGGTTTCAGATCCTTGAAGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)