EMAIL THIS PAGE TO A FRIEND

MAF

v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog

195 Gene Product Result for
Synonyms: CCA4 c-MAF
UniProtKB ID: O75444, Q66I47, Q9UP93
Gene ID:
Human(4094) Summary: The protein encoded by this gene is a DNA-binding, leucine zipper-containing transcription factor that acts as a homodimer or as a heterodimer. Depending on the binding site and binding partner, the encoded protein can be a transcriptional activator or repressor. This protein plays a role in the regulation of several cellular processes, including embryonic lens fiber cell development, increased T-cell susceptibility to apoptosis, and chondrocyte terminal differentiation. Defects in this gene are a cause of juvenile-onset pulverulent cataract as well as congenital cerulean cataract 4 (CCA4). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(17132) avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog
Rat(54267) v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog
domestic guinea pig(100725532) v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian)
naked mole-rat(101698937) v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian)
Zebrafish(114467) v-maf musculoaponeurotic fibrosarcoma (avian) oncogene homolog
cow(782481) v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian)
chicken(693248) v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031804 Rosetta Predictions human pricing
NM_005360 Rosetta Predictions human pricing
NM_019318 Rosetta Predictions rat pricing
NM_001025577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202727 predicted 2195
2 SASI_Hs01_00202728 predicted 2337
3 SASI_Hs01_00202729 predicted 2193
4 SASI_Hs01_00202730 predicted 2277
5 SASI_Hs01_00202731 predicted 1746
6 SASI_Hs01_00202732 predicted 2330
7 SASI_Hs01_00202733 predicted 1945
8 SASI_Hs01_00202734 predicted 1056
9 SASI_Hs01_00202735 predicted 2279
10 SASI_Hs01_00202736 predicted 2199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213434 predicted 1949
2 SASI_Hs01_00213435 predicted 1741
3 SASI_Hs01_00213436 predicted 1054
4 SASI_Hs01_00213437 predicted 1991
5 SASI_Hs01_00213439 predicted 883
6 SASI_Hs01_00213440 predicted 2073
7 SASI_Hs01_00213441 predicted 1154
8 SASI_Hs01_00213442 predicted 1788
9 SASI_Hs02_00339453 predicted 1944
10 SASI_Hs02_00339454 predicted 1989
11 SASI_Hs01_00213433 predicted 1994
12 SASI_Hs01_00213438 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059019 predicted 1175
2 SASI_Rn01_00059020 predicted 276
3 SASI_Rn01_00059022 predicted 399
4 SASI_Rn01_00059023 predicted 291
5 SASI_Rn01_00059024 predicted 1096
6 SASI_Rn01_00059025 predicted 406
7 SASI_Rn02_00262286 predicted 1098
8 SASI_Rn02_00262287 predicted 408
9 SASI_Rn01_00059028 predicted 306
10 SASI_Rn02_00262288 predicted 246
11 SASI_Rn01_00059021 predicted 228
12 SASI_Rn01_00059026 predicted 1188
13 SASI_Rn01_00059027 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159120 predicted 1030
2 SASI_Mm01_00159121 predicted 256
3 SASI_Mm01_00159122 predicted 952
4 SASI_Mm01_00159123 predicted 263
5 SASI_Mm01_00159124 predicted 950
6 SASI_Mm01_00159125 predicted 263
7 SASI_Mm01_00159126 predicted 1039
8 SASI_Mm01_00159127 predicted 289
9 SASI_Mm01_00159128 predicted 279
10 SASI_Mm01_00159129 predicted 277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005360
VALIDATED
MAF MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005360.4-2248s21c1
Sequence:CCGGTTTATGGTGTGTGCAAGTAAACTCGAGTTTACTTGCACACACCATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-1941s21c1
Sequence:CCGGTAACTGAGCCCACTCGCAAGTCTCGAGACTTGCGAGTGGGCTCAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-1086s21c1
Sequence:CCGGTGGAAGACTACTACTGGATGACTCGAGTCATCCAGTAGTAGTCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-1970s21c1
Sequence:CCGGTCAGTGGGATACGCCACATTTCTCGAGAAATGTGGCGTATCCCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005360.4-2153s21c1
Sequence:CCGGGTTAGAGAAGAAGGCTATTAACTCGAGTTAATAGCCTTCTTCTCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-886s21c1
Sequence:CCGGTGTTAATGACTTCGATCTGATCTCGAGATCAGATCGAAGTCATTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-2011s21c1
Sequence:CCGGACTTACCAGTGTGTTCACAAACTCGAGTTTGTGAACACACTGGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-2034s21c1
Sequence:CCGGGAAATTTGTGTGAGAGCTGTACTCGAGTACAGCTCTCACACAAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005360.x-1839s1c1
Sequence:CCGGCAAGGAGAAATACGAGAAGTTCTCGAGAACTTCTCGTATTTCTCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005360.x-1070s1c1
Sequence:CCGGTGGAAGACTACTACTGGATGACTCGAGTCATCCAGTAGTAGTCTTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005360.x-1838s1c1
Sequence:CCGGACAAGGAGAAATACGAGAAGTCTCGAGACTTCTCGTATTTCTCCTTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005360.x-1067s1c1
Sequence:CCGGACCTGGAAGACTACTACTGGACTCGAGTCCAGTAGTAGTCTTCCAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005360
VALIDATED
MAF MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005360.4-2248s21c1
Sequence:CCGGTTTATGGTGTGTGCAAGTAAACTCGAGTTTACTTGCACACACCATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-1941s21c1
Sequence:CCGGTAACTGAGCCCACTCGCAAGTCTCGAGACTTGCGAGTGGGCTCAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-1086s21c1
Sequence:CCGGTGGAAGACTACTACTGGATGACTCGAGTCATCCAGTAGTAGTCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-1970s21c1
Sequence:CCGGTCAGTGGGATACGCCACATTTCTCGAGAAATGTGGCGTATCCCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005360.4-2153s21c1
Sequence:CCGGGTTAGAGAAGAAGGCTATTAACTCGAGTTAATAGCCTTCTTCTCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-886s21c1
Sequence:CCGGTGTTAATGACTTCGATCTGATCTCGAGATCAGATCGAAGTCATTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-2011s21c1
Sequence:CCGGACTTACCAGTGTGTTCACAAACTCGAGTTTGTGAACACACTGGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-2034s21c1
Sequence:CCGGGAAATTTGTGTGAGAGCTGTACTCGAGTACAGCTCTCACACAAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005360.x-1839s1c1
Sequence:CCGGCAAGGAGAAATACGAGAAGTTCTCGAGAACTTCTCGTATTTCTCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005360.x-1070s1c1
Sequence:CCGGTGGAAGACTACTACTGGATGACTCGAGTCATCCAGTAGTAGTCTTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005360.x-1838s1c1
Sequence:CCGGACAAGGAGAAATACGAGAAGTCTCGAGACTTCTCGTATTTCTCCTTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005360.x-1067s1c1
Sequence:CCGGACCTGGAAGACTACTACTGGACTCGAGTCCAGTAGTAGTCTTCCAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005360
VALIDATED
MAF MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005360.4-2248s21c1
Sequence:CCGGTTTATGGTGTGTGCAAGTAAACTCGAGTTTACTTGCACACACCATAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-1941s21c1
Sequence:CCGGTAACTGAGCCCACTCGCAAGTCTCGAGACTTGCGAGTGGGCTCAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-1086s21c1
Sequence:CCGGTGGAAGACTACTACTGGATGACTCGAGTCATCCAGTAGTAGTCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-1970s21c1
Sequence:CCGGTCAGTGGGATACGCCACATTTCTCGAGAAATGTGGCGTATCCCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005360.4-2153s21c1
Sequence:CCGGGTTAGAGAAGAAGGCTATTAACTCGAGTTAATAGCCTTCTTCTCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-886s21c1
Sequence:CCGGTGTTAATGACTTCGATCTGATCTCGAGATCAGATCGAAGTCATTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-2011s21c1
Sequence:CCGGACTTACCAGTGTGTTCACAAACTCGAGTTTGTGAACACACTGGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005360.4-2034s21c1
Sequence:CCGGGAAATTTGTGTGAGAGCTGTACTCGAGTACAGCTCTCACACAAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005360.x-1839s1c1
Sequence:CCGGCAAGGAGAAATACGAGAAGTTCTCGAGAACTTCTCGTATTTCTCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005360.x-1070s1c1
Sequence:CCGGTGGAAGACTACTACTGGATGACTCGAGTCATCCAGTAGTAGTCTTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005360.x-1838s1c1
Sequence:CCGGACAAGGAGAAATACGAGAAGTCTCGAGACTTCTCGTATTTCTCCTTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005360.x-1067s1c1
Sequence:CCGGACCTGGAAGACTACTACTGGACTCGAGTCCAGTAGTAGTCTTCCAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025577
VALIDATED
MAF MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025577.2-1054s1c1
Sequence:CCGGCAAGGAGAAATACGAGAAGCTCTCGAGAGCTTCTCGTATTTCTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025577.2-106s1c1
Sequence:CCGGCGATCTGATGAAGTTTGAAGTCTCGAGACTTCAAACTTCATCAGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-1051s1c1
Sequence:CCGGCTACAAGGAGAAATACGAGAACTCGAGTTCTCGTATTTCTCCTTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025577.2-2819s1c1
Sequence:CCGGGCTACAGATAAAGGAATGTTACTCGAGTAACATTCCTTTATCTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-110s1c1
Sequence:CCGGCTGATGAAGTTTGAAGTGAAACTCGAGTTTCACTTCAAACTTCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-3371s1c1
Sequence:CCGGCCTGTCTTAGAAAGAAAGAAACTCGAGTTTCTTTCTTTCTAAGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-2433s1c1
Sequence:CCGGGCTTTGAGTTACAATGAACTTCTCGAGAAGTTCATTGTAACTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025577
VALIDATED
MAF MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025577.2-1054s1c1
Sequence:CCGGCAAGGAGAAATACGAGAAGCTCTCGAGAGCTTCTCGTATTTCTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025577.2-106s1c1
Sequence:CCGGCGATCTGATGAAGTTTGAAGTCTCGAGACTTCAAACTTCATCAGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-1051s1c1
Sequence:CCGGCTACAAGGAGAAATACGAGAACTCGAGTTCTCGTATTTCTCCTTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025577.2-2819s1c1
Sequence:CCGGGCTACAGATAAAGGAATGTTACTCGAGTAACATTCCTTTATCTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-110s1c1
Sequence:CCGGCTGATGAAGTTTGAAGTGAAACTCGAGTTTCACTTCAAACTTCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-3371s1c1
Sequence:CCGGCCTGTCTTAGAAAGAAAGAAACTCGAGTTTCTTTCTTTCTAAGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-2433s1c1
Sequence:CCGGGCTTTGAGTTACAATGAACTTCTCGAGAAGTTCATTGTAACTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025577
VALIDATED
MAF MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025577.2-1054s1c1
Sequence:CCGGCAAGGAGAAATACGAGAAGCTCTCGAGAGCTTCTCGTATTTCTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025577.2-106s1c1
Sequence:CCGGCGATCTGATGAAGTTTGAAGTCTCGAGACTTCAAACTTCATCAGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-1051s1c1
Sequence:CCGGCTACAAGGAGAAATACGAGAACTCGAGTTCTCGTATTTCTCCTTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025577.2-2819s1c1
Sequence:CCGGGCTACAGATAAAGGAATGTTACTCGAGTAACATTCCTTTATCTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-110s1c1
Sequence:CCGGCTGATGAAGTTTGAAGTGAAACTCGAGTTTCACTTCAAACTTCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-3371s1c1
Sequence:CCGGCCTGTCTTAGAAAGAAAGAAACTCGAGTTTCTTTCTTTCTAAGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025577.2-2433s1c1
Sequence:CCGGGCTTTGAGTTACAATGAACTTCTCGAGAAGTTCATTGTAACTCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)