EMAIL THIS PAGE TO A FRIEND

MAFA

v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A

67 Gene Product Result for
Synonyms: RIPE3b1 hMafA
UniProtKB ID: Q8NHW3
Gene ID:
Human(389692) Summary: MAFA is a transcription factor that binds RIPE3b, a conserved enhancer element that regulates pancreatic beta cell-specific expression of the insulin gene (INS; MIM 176730) (Olbrot et al., 2002 [PubMed 12011435]
Mouse(378435) v-maf musculoaponeurotic fibrosarcoma oncogene family, protein A (avian)
Rat(366949) v-maf avian musculoaponeurotic fibrosarcoma oncogene A
Zebrafish(100000492) v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian)
chicken(395881) v-maf musculoaponeurotic fibrosarcoma oncogene homolog A
dog(100684427) v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian)
cow(618421) v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A
domestic guinea pig(100733756) v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian)
naked mole-rat(101725333) v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201589 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MABF465 Anti-KLRG1 Antibody (mouse), APC, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), APC, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF733 Anti-KLRG1 Antibody (mouse), APC, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), APC, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF467 Anti-KLRG1 Antibody (mouse), clone 2F1 This Golden Syrian Hamster Monoclonal Antibody Anti-KLRG1 (mouse), clone 2F1, Cat. No. MABF467 is validated for use in Immunoprecipitation, Flow Cytometry for the detection of KLRG1. pricing
MABF468 Anti-KLRG1 Antibody (mouse), FITC, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), FITC, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF735 Anti-KLRG1 Antibody (mouse), FITC, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), FITC, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF466 Anti-KLRG1 Antibody (mouse), PE, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), PE, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF734 Anti-KLRG1 Antibody (mouse), PE, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), PE, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF144B Anti-KLRG1 (mouse), violetFluor™ 450, clone 2F1 Antibody Anti-KLRG1 (mouse), violetFluor™ 450, clone 2F1 Antibody is an antibody against KLRG1 for use in Flow Cytometry. pricing
ABE1404 Anti-MAFA Antibody This Anti-MAFA Antibody is validated for use in Western Blotting and Immunocytochemistry for the detection of MAFA. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_201589 Rosetta Predictions human pricing
XM_345846 Rosetta Predictions rat pricing
XR_008949 Rosetta Predictions rat pricing
NM_194350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175466 predicted 826
2 SASI_Hs01_00175467 predicted 748
3 SASI_Hs01_00175469 predicted 842
4 SASI_Hs01_00175470 predicted 910
5 SASI_Hs01_00175471 predicted 908
6 SASI_Hs01_00175472 predicted 420
7 SASI_Hs01_00175473 predicted 42
8 SASI_Hs01_00175474 predicted 762
9 SASI_Hs01_00175475 predicted 58
10 SASI_Hs01_00175468 predicted 71
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164180 predicted 777
2 SASI_Rn01_00164181 predicted 768
3 SASI_Rn01_00164182 predicted 380
4 SASI_Rn01_00164184 predicted 72
5 SASI_Rn01_00164185 predicted 859
6 SASI_Rn01_00164186 predicted 1050
7 SASI_Rn02_00398743 predicted 415
8 SASI_Rn02_00398744 predicted 349
9 SASI_Rn02_00398745 predicted 56
10 SASI_Rn02_00398746 predicted 791
11 SASI_Rn01_00164183 predicted 934
12 SASI_Rn01_00164187 predicted 356
13 SASI_Rn01_00164188 predicted 878
14 SASI_Rn01_00164189 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00133809 predicted 468
2 SASI_Rn01_00133810 predicted 468
3 SASI_Rn01_00133811 predicted 75
4 SASI_Rn01_00133813 predicted 551
5 SASI_Rn01_00133814 predicted 739
6 SASI_Rn01_00133816 predicted 632
7 SASI_Rn02_00418314 predicted 106
8 SASI_Rn02_00418315 predicted 40
9 SASI_Rn02_00418316 predicted 485
10 SASI_Rn01_00133812 predicted 627
11 SASI_Rn01_00133815 predicted 47
12 SASI_Rn01_00133817 predicted 565
13 SASI_Rn01_00133818 predicted 54
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163755 predicted 766
2 SASI_Mm01_00163756 predicted 760
3 SASI_Mm01_00163757 predicted 853
4 SASI_Mm01_00163758 predicted 373
5 SASI_Mm01_00163759 predicted 73
6 SASI_Mm01_00163760 predicted 847
7 SASI_Mm01_00163761 predicted 923
8 SASI_Mm01_00163762 predicted 930
9 SASI_Mm01_00163763 predicted 865
10 SASI_Mm01_00163764 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201589
MAFA MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201589.2-752s21c1
Sequence:CCGGAGGTCATCCGGCTCAAGCAGACTCGAGTCTGCTTGAGCCGGATGACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201589.2-930s21c1
Sequence:CCGGCAAGGAGAAATACGAGAAGCTCTCGAGAGCTTCTCGTATTTCTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-75s1c1
Sequence:CCGGCCTGATGAAGTTCGAGGTGAACTCGAGTTCACCTCGAACTTCATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-62s1c1
Sequence:CCGGTCAACGACTTCGACCTGATGACTCGAGTCATCAGGTCGAAGTCGTTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-360s1c1
Sequence:CCGGCGGCTACCAGCATCACCTCAACTCGAGTTGAGGTGATGCTGGTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-477s1c1
Sequence:CCGGCGCCGCAGCCTACGAGGCTTTCTCGAGAAAGCCTCGTAGGCTGCGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201589
MAFA MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201589.2-752s21c1
Sequence:CCGGAGGTCATCCGGCTCAAGCAGACTCGAGTCTGCTTGAGCCGGATGACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201589.2-930s21c1
Sequence:CCGGCAAGGAGAAATACGAGAAGCTCTCGAGAGCTTCTCGTATTTCTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-75s1c1
Sequence:CCGGCCTGATGAAGTTCGAGGTGAACTCGAGTTCACCTCGAACTTCATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-62s1c1
Sequence:CCGGTCAACGACTTCGACCTGATGACTCGAGTCATCAGGTCGAAGTCGTTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-360s1c1
Sequence:CCGGCGGCTACCAGCATCACCTCAACTCGAGTTGAGGTGATGCTGGTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-477s1c1
Sequence:CCGGCGCCGCAGCCTACGAGGCTTTCTCGAGAAAGCCTCGTAGGCTGCGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201589
MAFA MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201589.2-752s21c1
Sequence:CCGGAGGTCATCCGGCTCAAGCAGACTCGAGTCTGCTTGAGCCGGATGACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201589.2-930s21c1
Sequence:CCGGCAAGGAGAAATACGAGAAGCTCTCGAGAGCTTCTCGTATTTCTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-75s1c1
Sequence:CCGGCCTGATGAAGTTCGAGGTGAACTCGAGTTCACCTCGAACTTCATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-62s1c1
Sequence:CCGGTCAACGACTTCGACCTGATGACTCGAGTCATCAGGTCGAAGTCGTTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-360s1c1
Sequence:CCGGCGGCTACCAGCATCACCTCAACTCGAGTTGAGGTGATGCTGGTAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201589.1-477s1c1
Sequence:CCGGCGCCGCAGCCTACGAGGCTTTCTCGAGAAAGCCTCGTAGGCTGCGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194350
MAFA MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-819s1c1
Sequence:CCGGCGCGCAGTCGTGCCGCTTCAACTCGAGTTGAAGCGGCACGACTGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-330s1c1
Sequence:CCGGGCTGGAGGATCTGTACTGGATCTCGAGATCCAGTACAGATCCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-766s1c1
Sequence:CCGGGAGGAGGTCATCCGACTGAAACTCGAGTTTCAGTCGGATGACCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-63s1c1
Sequence:CCGGCAACGACTTCGACCTGATGAACTCGAGTTCATCAGGTCGAAGTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-702s1c1
Sequence:CCGGCGACGACCAGCTGGTATCCATCTCGAGATGGATACCAGCTGGTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194350
MAFA MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-819s1c1
Sequence:CCGGCGCGCAGTCGTGCCGCTTCAACTCGAGTTGAAGCGGCACGACTGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-330s1c1
Sequence:CCGGGCTGGAGGATCTGTACTGGATCTCGAGATCCAGTACAGATCCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-766s1c1
Sequence:CCGGGAGGAGGTCATCCGACTGAAACTCGAGTTTCAGTCGGATGACCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-63s1c1
Sequence:CCGGCAACGACTTCGACCTGATGAACTCGAGTTCATCAGGTCGAAGTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-702s1c1
Sequence:CCGGCGACGACCAGCTGGTATCCATCTCGAGATGGATACCAGCTGGTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194350
MAFA MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-819s1c1
Sequence:CCGGCGCGCAGTCGTGCCGCTTCAACTCGAGTTGAAGCGGCACGACTGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-330s1c1
Sequence:CCGGGCTGGAGGATCTGTACTGGATCTCGAGATCCAGTACAGATCCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-766s1c1
Sequence:CCGGGAGGAGGTCATCCGACTGAAACTCGAGTTTCAGTCGGATGACCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-63s1c1
Sequence:CCGGCAACGACTTCGACCTGATGAACTCGAGTTCATCAGGTCGAAGTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194350.1-702s1c1
Sequence:CCGGCGACGACCAGCTGGTATCCATCTCGAGATGGATACCAGCTGGTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)