EMAIL THIS PAGE TO A FRIEND

MAFB

v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B

98 Gene Product Result for
Synonyms: KRML MCTO
UniProtKB ID: Q9Y5Q3, B3KNE1, Q9H1F1
Gene ID:
Human(9935) Summary: The protein encoded by this gene is a basic leucine zipper (bZIP) transcription factor that plays an important role in the regulation of lineage-specific hematopoiesis. The encoded nuclear protein represses ETS1-mediated transcription of erythroid-specific genes in myeloid cells. This gene contains no introns. [provided by RefSeq, Jul 2008]
Mouse(16658) v-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian)
Rat(54264) v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B
domestic guinea pig(100733495) v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)
sheep(554333) v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)
chicken(419173) v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)
domestic cat(101093426) v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)
cow(532376) v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108488 Anti-MAFB affinity isolated antibody rabbit, rat, guinea pig, bovine, human
immunohistochemistry, western blot pricing
AV33683 Anti-MAFB (AB1) antibody produced in rabbit affinity isolated antibody zebrafish, mouse, guinea pig, human, rabbit, rat
immunohistochemistry, western blot pricing
AV33682 Anti-MAFB (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, human, guinea pig, bovine, mouse, rat
immunohistochemistry, western blot pricing
HPA005653 Anti-MAFB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB2101415 Anti-MAFB antibody produced in rabbit affinity isolated antibody bovine, horse, mouse, human, rat, dog, guinea pig
western blot pricing
SAB4100455 Monoclonal Anti-MAFB antibody produced in mouse clone MAFB-B392, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005461 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005461 Rosetta Predictions human pricing
NM_019316 Rosetta Predictions rat pricing
NM_010658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197228 predicted 1858
2 SASI_Hs02_00339624 predicted 1731
3 SASI_Hs01_00197230 predicted 622
4 SASI_Hs01_00197231 predicted 1152
5 SASI_Hs02_00339625 predicted 1331
6 SASI_Hs01_00197232 predicted 1716
7 SASI_Hs01_00197233 predicted 452
8 SASI_Hs01_00197234 predicted 1261
9 SASI_Hs01_00197236 predicted 647
10 SASI_Hs01_00197237 predicted 627
11 SASI_Hs01_00197229 predicted 1846
12 SASI_Hs01_00197235 predicted 1679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116504 predicted 1170
2 SASI_Rn01_00116505 predicted 1206
3 SASI_Rn02_00262281 predicted 1171
4 SASI_Rn01_00116507 predicted 800
5 SASI_Rn01_00116509 predicted 1096
6 SASI_Rn02_00262282 predicted 1208
7 SASI_Rn01_00116511 predicted 906
8 SASI_Rn01_00116512 predicted 814
9 SASI_Rn01_00116513 predicted 912
10 SASI_Rn02_00262283 predicted 1111
11 SASI_Rn01_00116506 predicted 682
12 SASI_Rn01_00116508 predicted 980
13 SASI_Rn01_00116510 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048113 predicted 1473
2 SASI_Mm01_00048115 predicted 1400
3 SASI_Mm01_00048116 predicted 1095
4 SASI_Mm01_00048117 predicted 1516
5 SASI_Mm01_00048118 predicted 1599
6 SASI_Mm01_00048119 predicted 1206
7 SASI_Mm01_00048120 predicted 1123
8 SASI_Mm01_00048121 predicted 1401
9 SASI_Mm02_00319058 predicted 1516
10 SASI_Mm01_00048122 predicted 1234
11 SASI_Mm01_00048114 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010658
VALIDATED
MAFB MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010658.2-2170s1c1
Sequence:CCGGGCTGAGTCTTTGTTTGGGTTTCTCGAGAAACCCAAACAAAGACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010658.2-548s1c1
Sequence:CCGGCCCAGCTTCAGTCCGACTGAACTCGAGTTCAGTCGGACTGAAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010658.2-1216s1c1
Sequence:CCGGCTACAAGGTCAAGTGCGAGAACTCGAGTTCTCGCACTTGACCTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010658.2-412s1c1
Sequence:CCGGCCTTCTCAAGTTCGACGTGAACTCGAGTTCACGTCGAACTTGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010658.3-2222s21c1
Sequence:CCGGGCTGAGTCTTTGTTTGGGTTTCTCGAGAAACCCAAACAAAGACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010658.3-1268s21c1
Sequence:CCGGCTACAAGGTCAAGTGCGAGAACTCGAGTTCTCGCACTTGACCTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010658.2-1090s1c1
Sequence:CCGGCGCCCAGTCGTGCAGGTATAACTCGAGTTATACCTGCACGACTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010658.3-1142s21c1
Sequence:CCGGCGCCCAGTCGTGCAGGTATAACTCGAGTTATACCTGCACGACTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010658.3-600s21c1
Sequence:CCGGCCCAGCTTCAGTCCGACTGAACTCGAGTTCAGTCGGACTGAAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010658
VALIDATED
MAFB MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010658.2-2170s1c1
Sequence:CCGGGCTGAGTCTTTGTTTGGGTTTCTCGAGAAACCCAAACAAAGACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010658.2-548s1c1
Sequence:CCGGCCCAGCTTCAGTCCGACTGAACTCGAGTTCAGTCGGACTGAAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010658.2-1216s1c1
Sequence:CCGGCTACAAGGTCAAGTGCGAGAACTCGAGTTCTCGCACTTGACCTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010658.2-412s1c1
Sequence:CCGGCCTTCTCAAGTTCGACGTGAACTCGAGTTCACGTCGAACTTGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010658.3-2222s21c1
Sequence:CCGGGCTGAGTCTTTGTTTGGGTTTCTCGAGAAACCCAAACAAAGACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010658.3-1268s21c1
Sequence:CCGGCTACAAGGTCAAGTGCGAGAACTCGAGTTCTCGCACTTGACCTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010658.2-1090s1c1
Sequence:CCGGCGCCCAGTCGTGCAGGTATAACTCGAGTTATACCTGCACGACTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010658.3-1142s21c1
Sequence:CCGGCGCCCAGTCGTGCAGGTATAACTCGAGTTATACCTGCACGACTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010658.3-600s21c1
Sequence:CCGGCCCAGCTTCAGTCCGACTGAACTCGAGTTCAGTCGGACTGAAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010658
VALIDATED
MAFB MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010658.2-2170s1c1
Sequence:CCGGGCTGAGTCTTTGTTTGGGTTTCTCGAGAAACCCAAACAAAGACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010658.2-548s1c1
Sequence:CCGGCCCAGCTTCAGTCCGACTGAACTCGAGTTCAGTCGGACTGAAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010658.2-1216s1c1
Sequence:CCGGCTACAAGGTCAAGTGCGAGAACTCGAGTTCTCGCACTTGACCTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010658.2-412s1c1
Sequence:CCGGCCTTCTCAAGTTCGACGTGAACTCGAGTTCACGTCGAACTTGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010658.3-2222s21c1
Sequence:CCGGGCTGAGTCTTTGTTTGGGTTTCTCGAGAAACCCAAACAAAGACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010658.3-1268s21c1
Sequence:CCGGCTACAAGGTCAAGTGCGAGAACTCGAGTTCTCGCACTTGACCTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010658.2-1090s1c1
Sequence:CCGGCGCCCAGTCGTGCAGGTATAACTCGAGTTATACCTGCACGACTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010658.3-1142s21c1
Sequence:CCGGCGCCCAGTCGTGCAGGTATAACTCGAGTTATACCTGCACGACTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010658.3-600s21c1
Sequence:CCGGCCCAGCTTCAGTCCGACTGAACTCGAGTTCAGTCGGACTGAAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005461
VALIDATED
MAFB MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005461.3-641s21c1
Sequence:CCGGGTACTGGATGGCGAGCAACTACTCGAGTAGTTGCTCGCCATCCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-2519s1c1
Sequence:CCGGGCCTTGTCTTATGGTCAAATTCTCGAGAATTTGACCATAAGACAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-747s1c1
Sequence:CCGGCTGCAAAGCTTCGACAGCTTTCTCGAGAAAGCTGTCGAAGCTTTGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-1140s1c1
Sequence:CCGGGCCCAGTCTTGCAGGTATAAACTCGAGTTTATACCTGCAAGACTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-464s1c1
Sequence:CCGGGCTCAAGTTCGACGTGAAGAACTCGAGTTCTTCACGTCGAACTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005461.3-1187s1c1
Sequence:CCGGGAATGAGAAGACGCAGCTCATCTCGAGATGAGCTGCGTCTTCTCATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005461.3-1267s21c1
Sequence:CCGGACAAGGTCAAGTGCGAGAAACCTCGAGGTTTCTCGCACTTGACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005461.3-464s21c1
Sequence:CCGGGCTCAAGTTCGACGTGAAGAACTCGAGTTCTTCACGTCGAACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005461.3-2519s21c1
Sequence:CCGGGCCTTGTCTTATGGTCAAATTCTCGAGAATTTGACCATAAGACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005461.3-1140s21c1
Sequence:CCGGGCCCAGTCTTGCAGGTATAAACTCGAGTTTATACCTGCAAGACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005461
VALIDATED
MAFB MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005461.3-641s21c1
Sequence:CCGGGTACTGGATGGCGAGCAACTACTCGAGTAGTTGCTCGCCATCCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-2519s1c1
Sequence:CCGGGCCTTGTCTTATGGTCAAATTCTCGAGAATTTGACCATAAGACAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-747s1c1
Sequence:CCGGCTGCAAAGCTTCGACAGCTTTCTCGAGAAAGCTGTCGAAGCTTTGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-1140s1c1
Sequence:CCGGGCCCAGTCTTGCAGGTATAAACTCGAGTTTATACCTGCAAGACTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-464s1c1
Sequence:CCGGGCTCAAGTTCGACGTGAAGAACTCGAGTTCTTCACGTCGAACTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005461.3-1187s1c1
Sequence:CCGGGAATGAGAAGACGCAGCTCATCTCGAGATGAGCTGCGTCTTCTCATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005461.3-1267s21c1
Sequence:CCGGACAAGGTCAAGTGCGAGAAACCTCGAGGTTTCTCGCACTTGACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005461.3-464s21c1
Sequence:CCGGGCTCAAGTTCGACGTGAAGAACTCGAGTTCTTCACGTCGAACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005461.3-2519s21c1
Sequence:CCGGGCCTTGTCTTATGGTCAAATTCTCGAGAATTTGACCATAAGACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005461.3-1140s21c1
Sequence:CCGGGCCCAGTCTTGCAGGTATAAACTCGAGTTTATACCTGCAAGACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005461
VALIDATED
MAFB MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005461.3-641s21c1
Sequence:CCGGGTACTGGATGGCGAGCAACTACTCGAGTAGTTGCTCGCCATCCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-2519s1c1
Sequence:CCGGGCCTTGTCTTATGGTCAAATTCTCGAGAATTTGACCATAAGACAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-747s1c1
Sequence:CCGGCTGCAAAGCTTCGACAGCTTTCTCGAGAAAGCTGTCGAAGCTTTGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-1140s1c1
Sequence:CCGGGCCCAGTCTTGCAGGTATAAACTCGAGTTTATACCTGCAAGACTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005461.3-464s1c1
Sequence:CCGGGCTCAAGTTCGACGTGAAGAACTCGAGTTCTTCACGTCGAACTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005461.3-1187s1c1
Sequence:CCGGGAATGAGAAGACGCAGCTCATCTCGAGATGAGCTGCGTCTTCTCATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005461.3-1267s21c1
Sequence:CCGGACAAGGTCAAGTGCGAGAAACCTCGAGGTTTCTCGCACTTGACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005461.3-464s21c1
Sequence:CCGGGCTCAAGTTCGACGTGAAGAACTCGAGTTCTTCACGTCGAACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005461.3-2519s21c1
Sequence:CCGGGCCTTGTCTTATGGTCAAATTCTCGAGAATTTGACCATAAGACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005461.3-1140s21c1
Sequence:CCGGGCCCAGTCTTGCAGGTATAAACTCGAGTTTATACCTGCAAGACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)