EMAIL THIS PAGE TO A FRIEND

MAFF

v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F

83 Gene Product Result for
Synonyms: U-MAF hMafF
UniProtKB ID: Q9ULX9, B4DV49, Q9Y525
Gene ID:
Human(23764) Summary: The protein encoded by this gene is a basic leucine zipper (bZIP) transcription factor that lacks a transactivation domain. It is known to bind the US-2 DNA element in the promoter of the oxytocin receptor (OTR) gene and most likely heterodimerizes with other leucine zipper-containing proteins to enhance expression of the OTR gene during term pregnancy. The encoded protein can also form homodimers, and since it lacks a transactivation domain, the homodimer may act as a repressor of transcription. This gene may also be involved in the cellular stress response. Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Mouse(17133) v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F (avian)
Rat(366960) v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F
Zebrafish(393307) v-maf musculoaponeurotic fibrosarcoma oncogene homolog f (avian)
dog(481255) v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)
domestic cat(101095591) v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)
cow(617914) v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)
chicken(395519) v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)
sheep(101121166) v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)
domestic guinea pig(100733417) v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)
naked mole-rat(101710305) v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012323 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152451 MISSION® esiRNA esiRNA human MAFF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012323 Rosetta Predictions human pricing
NM_152878 Rosetta Predictions human pricing
NM_001130573 Rosetta Predictions rat pricing
NM_010755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145039 predicted 1011
2 SASI_Hs01_00145040 predicted 1012
3 SASI_Hs01_00145041 predicted 1025
4 SASI_Hs01_00145042 predicted 1079
5 SASI_Hs01_00145043 predicted 1138
6 SASI_Hs01_00145044 predicted 983
7 SASI_Hs01_00145045 predicted 1109
8 SASI_Hs01_00145046 predicted 1068
9 SASI_Hs02_00344109 predicted 1123
10 SASI_Hs02_00344110 predicted 1088
11 SASI_Hs01_00145047 predicted 266
12 SASI_Hs01_00145048 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231882 predicted 963
2 SASI_Hs01_00231883 predicted 965
3 SASI_Hs01_00231884 predicted 967
4 SASI_Hs01_00231885 predicted 1029
5 SASI_Hs01_00231887 predicted 932
6 SASI_Hs01_00231889 predicted 1022
7 SASI_Hs02_00366841 predicted 224
8 SASI_Hs02_00366842 predicted 2259
9 SASI_Hs02_00366843 predicted 1878
10 SASI_Hs02_00366844 predicted 1821
11 SASI_Hs01_00231886 predicted 1097
12 SASI_Hs01_00231888 predicted 1062
13 SASI_Hs01_00231890 predicted 221
14 SASI_Hs01_00231891 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255899 predicted 510
2 SASI_Rn02_00255900 predicted 997
3 SASI_Rn02_00255901 predicted 1074
4 SASI_Rn02_00255902 predicted 312
5 SASI_Rn02_00255903 predicted 690
6 SASI_Rn02_00255904 predicted 134
7 SASI_Rn02_00255905 predicted 602
8 SASI_Rn02_00255906 predicted 724
9 SASI_Rn02_00255907 predicted 986
10 SASI_Rn02_00255908 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106817 predicted 1001
2 SASI_Mm01_00106818 predicted 950
3 SASI_Mm01_00106819 predicted 963
4 SASI_Mm01_00106820 predicted 1019
5 SASI_Mm01_00106821 predicted 799
6 SASI_Mm01_00106823 predicted 127
7 SASI_Mm01_00106824 predicted 774
8 SASI_Mm01_00106825 predicted 804
9 SASI_Mm01_00106826 predicted 672
10 SASI_Mm02_00319275 predicted 1064
11 SASI_Mm01_00106822 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012323
MAFF MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012323.3-1043s21c1
Sequence:CCGGTCGCCCTTGGCTGAAAGTTTACTCGAGTAAACTTTCAGCCAAGGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-391s1c1
Sequence:CCGGCGAGGAGGTGACACGGCTCAACTCGAGTTGAGCCGTGTCACCTCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012323.3-1134s21c1
Sequence:CCGGTCTTGGAAACTGCTCTTATTGCTCGAGCAATAAGAGCAGTTTCCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-469s1c1
Sequence:CCGGCGTGTGCCAGAAGGAGGAGCTCTCGAGAGCTCCTCCTTCTGGCACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-493s1c1
Sequence:CCGGGAAGCAGAAGTCGGAGCTGGACTCGAGTCCAGCTCCGACTTCTGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-301s1c1
Sequence:CCGGGCTGAGCGAGAACACGCCGCACTCGAGTGCGGCGTGTTCTCGCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012323.3-1079s21c1
Sequence:CCGGGAGATACAGAGCCGGCTTAGACTCGAGTCTAAGCCGGCTCTGTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-280s1c1
Sequence:CCGGAGCTCTAAAGATCAAGCGAGACTCGAGTCTCGCTTGATCTTTAGAGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012323
MAFF MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012323.3-1043s21c1
Sequence:CCGGTCGCCCTTGGCTGAAAGTTTACTCGAGTAAACTTTCAGCCAAGGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-391s1c1
Sequence:CCGGCGAGGAGGTGACACGGCTCAACTCGAGTTGAGCCGTGTCACCTCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012323.3-1134s21c1
Sequence:CCGGTCTTGGAAACTGCTCTTATTGCTCGAGCAATAAGAGCAGTTTCCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-469s1c1
Sequence:CCGGCGTGTGCCAGAAGGAGGAGCTCTCGAGAGCTCCTCCTTCTGGCACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-493s1c1
Sequence:CCGGGAAGCAGAAGTCGGAGCTGGACTCGAGTCCAGCTCCGACTTCTGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-301s1c1
Sequence:CCGGGCTGAGCGAGAACACGCCGCACTCGAGTGCGGCGTGTTCTCGCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012323.3-1079s21c1
Sequence:CCGGGAGATACAGAGCCGGCTTAGACTCGAGTCTAAGCCGGCTCTGTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-280s1c1
Sequence:CCGGAGCTCTAAAGATCAAGCGAGACTCGAGTCTCGCTTGATCTTTAGAGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012323
MAFF MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012323.3-1043s21c1
Sequence:CCGGTCGCCCTTGGCTGAAAGTTTACTCGAGTAAACTTTCAGCCAAGGGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-391s1c1
Sequence:CCGGCGAGGAGGTGACACGGCTCAACTCGAGTTGAGCCGTGTCACCTCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012323.3-1134s21c1
Sequence:CCGGTCTTGGAAACTGCTCTTATTGCTCGAGCAATAAGAGCAGTTTCCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-469s1c1
Sequence:CCGGCGTGTGCCAGAAGGAGGAGCTCTCGAGAGCTCCTCCTTCTGGCACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-493s1c1
Sequence:CCGGGAAGCAGAAGTCGGAGCTGGACTCGAGTCCAGCTCCGACTTCTGCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-301s1c1
Sequence:CCGGGCTGAGCGAGAACACGCCGCACTCGAGTGCGGCGTGTTCTCGCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012323.3-1079s21c1
Sequence:CCGGGAGATACAGAGCCGGCTTAGACTCGAGTCTAAGCCGGCTCTGTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012323.2-280s1c1
Sequence:CCGGAGCTCTAAAGATCAAGCGAGACTCGAGTCTCGCTTGATCTTTAGAGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010755
VALIDATED
MAFF MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1497s21c1
Sequence:GTACCGGGACTCTTCCACACTCTTATTTCTCGAGAAATAAGAGTGTGGAAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1519s21c1
Sequence:CCGGTTGCACGAATCTAAGTTATTCCTCGAGGAATAACTTAGATTCGTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1582s21c1
Sequence:CCGGGGCCCTGAGCTGGACTTATATCTCGAGATATAAGTCCAGCTCAGGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-807s21c1
Sequence:CCGGGGCTGAAAGTCCGGCTCAAATCTCGAGATTTGAGCCGGACTTTCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1009s21c1
Sequence:CCGGAGTCTTTGGAACGGATCAATGCTCGAGCATTGATCCGTTCCAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-1117s1c1
Sequence:CCGGGCCTTCTTACAGCTGCCTTAACTCGAGTTAAGGCAGCTGTAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-138s1c1
Sequence:CCGGCCTGAAGGTCAAGCGCGAGTTCTCGAGAACTCGCGCTTGACCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-432s1c1
Sequence:CCGGCGGCAAGTGTGAAGCGCTGCACTCGAGTGCAGCGCTTCACACTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-315s1c1
Sequence:CCGGCGTGAAGCGCGTGTGCCAGAACTCGAGTTCTGGCACACGCGCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-147s1c1
Sequence:CCGGCAAGCGCGAGTTGAGCGAGAACTCGAGTTCTCGCTCAACTCGCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010755
VALIDATED
MAFF MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1497s21c1
Sequence:GTACCGGGACTCTTCCACACTCTTATTTCTCGAGAAATAAGAGTGTGGAAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1519s21c1
Sequence:CCGGTTGCACGAATCTAAGTTATTCCTCGAGGAATAACTTAGATTCGTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1582s21c1
Sequence:CCGGGGCCCTGAGCTGGACTTATATCTCGAGATATAAGTCCAGCTCAGGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-807s21c1
Sequence:CCGGGGCTGAAAGTCCGGCTCAAATCTCGAGATTTGAGCCGGACTTTCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1009s21c1
Sequence:CCGGAGTCTTTGGAACGGATCAATGCTCGAGCATTGATCCGTTCCAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-1117s1c1
Sequence:CCGGGCCTTCTTACAGCTGCCTTAACTCGAGTTAAGGCAGCTGTAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-138s1c1
Sequence:CCGGCCTGAAGGTCAAGCGCGAGTTCTCGAGAACTCGCGCTTGACCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-432s1c1
Sequence:CCGGCGGCAAGTGTGAAGCGCTGCACTCGAGTGCAGCGCTTCACACTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-315s1c1
Sequence:CCGGCGTGAAGCGCGTGTGCCAGAACTCGAGTTCTGGCACACGCGCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-147s1c1
Sequence:CCGGCAAGCGCGAGTTGAGCGAGAACTCGAGTTCTCGCTCAACTCGCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010755
VALIDATED
MAFF MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1497s21c1
Sequence:GTACCGGGACTCTTCCACACTCTTATTTCTCGAGAAATAAGAGTGTGGAAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1519s21c1
Sequence:CCGGTTGCACGAATCTAAGTTATTCCTCGAGGAATAACTTAGATTCGTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1582s21c1
Sequence:CCGGGGCCCTGAGCTGGACTTATATCTCGAGATATAAGTCCAGCTCAGGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-807s21c1
Sequence:CCGGGGCTGAAAGTCCGGCTCAAATCTCGAGATTTGAGCCGGACTTTCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010755.3-1009s21c1
Sequence:CCGGAGTCTTTGGAACGGATCAATGCTCGAGCATTGATCCGTTCCAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-1117s1c1
Sequence:CCGGGCCTTCTTACAGCTGCCTTAACTCGAGTTAAGGCAGCTGTAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-138s1c1
Sequence:CCGGCCTGAAGGTCAAGCGCGAGTTCTCGAGAACTCGCGCTTGACCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-432s1c1
Sequence:CCGGCGGCAAGTGTGAAGCGCTGCACTCGAGTGCAGCGCTTCACACTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-315s1c1
Sequence:CCGGCGTGAAGCGCGTGTGCCAGAACTCGAGTTCTGGCACACGCGCTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010755.2-147s1c1
Sequence:CCGGCAAGCGCGAGTTGAGCGAGAACTCGAGTTCTCGCTCAACTCGCGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)