EMAIL THIS PAGE TO A FRIEND

MAFG

v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog G

111 Gene Product Result for
Synonyms: hMAF
UniProtKB ID: O15525
Gene ID:
Human(4097) Summary: Globin gene expression is regulated through nuclear factor erythroid-2 (NFE2) elements located in enhancer-like locus control regions positioned many kb upstream of alpha- and beta-gene clusters (summarized by Blank et al., 1997 [PubMed 9166829]
Mouse(17134) v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G (avian)
Rat(64188) v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog G
naked mole-rat(101718754) v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)
domestic guinea pig(100734785) v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)
sheep(101113422) v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)
chicken(769355) v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)
cow(515219) v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)
domestic cat(101090408) v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)
dog(607914) v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406099 Anti-MAFG antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV38143 Anti-MAFG antibody produced in rabbit affinity isolated antibody horse, rat, guinea pig, mouse, human, dog, bovine
western blot pricing
SAB2101416 Anti-MAFG antibody produced in rabbit affinity isolated antibody dog, mouse, human, rat, bovine, pig
western blot pricing
SAB2702084 Anti-MAFG antibody produced in rabbit rat, mouse, human
immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002359 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046031 MISSION® esiRNA esiRNA targeting mouse Mafg (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002359 Rosetta Predictions human pricing
NM_032711 Rosetta Predictions human pricing
NM_022386 Rosetta Predictions rat pricing
NM_010756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015606 predicted 502
2 SASI_Hs01_00015605 predicted 1149
3 SASI_Hs01_00015608 predicted 242
4 SASI_Hs01_00015609 predicted 654
5 SASI_Hs01_00015612 predicted 1062
6 SASI_Hs02_00333697 predicted 874
7 SASI_Hs02_00333698 predicted 674
8 SASI_Hs02_00333699 predicted 691
9 SASI_Hs02_00333700 predicted 868
10 SASI_Hs02_00333701 predicted 976
11 SASI_Hs01_00015607 predicted 417
12 SASI_Hs01_00015610 predicted 970
13 SASI_Hs01_00015611 predicted 1172
14 SASI_Hs01_00015613 predicted 1122
15 SASI_Hs01_00015614 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028326 predicted 500
2 SASI_Hs01_00028325 predicted 1142
3 SASI_Hs01_00028328 predicted 236
4 SASI_Hs01_00028329 predicted 650
5 SASI_Hs01_00028332 predicted 1052
6 SASI_Hs02_00360239 predicted 866
7 SASI_Hs02_00360240 predicted 665
8 SASI_Hs02_00360241 predicted 684
9 SASI_Hs02_00360242 predicted 866
10 SASI_Hs02_00360243 predicted 967
11 SASI_Hs01_00028327 predicted 411
12 SASI_Hs01_00028330 predicted 957
13 SASI_Hs01_00028331 predicted 1168
14 SASI_Hs01_00028333 predicted 1111
15 SASI_Hs01_00028334 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077485 predicted 385
2 SASI_Rn01_00077486 predicted 1094
3 SASI_Rn01_00077487 predicted 1108
4 SASI_Rn01_00077488 predicted 1107
5 SASI_Rn01_00077489 predicted 481
6 SASI_Rn01_00077490 predicted 463
7 SASI_Rn01_00077491 predicted 1106
8 SASI_Rn01_00077492 predicted 464
9 SASI_Rn01_00077493 predicted 1114
10 SASI_Rn01_00077494 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145856 predicted 1127
2 SASI_Mm01_00145858 predicted 1095
3 SASI_Mm01_00145859 predicted 1062
4 SASI_Mm01_00145860 predicted 1075
5 SASI_Mm01_00145861 predicted 509
6 SASI_Mm01_00145862 predicted 411
7 SASI_Mm01_00145863 predicted 1060
8 SASI_Mm01_00145864 predicted 417
9 SASI_Mm01_00145865 predicted 411
10 SASI_Mm02_00319276 predicted 1072
11 SASI_Mm01_00145857 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002359
MAFG MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog G
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002359.1-326s1c1
Sequence:CCGGCCTGTCCAAGGAGGAGATCGTCTCGAGACGATCTCCTCCTTGGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002359.1-640s1c1
Sequence:CCGGCCAGCGTCATCACAATAGTAACTCGAGTTACTATTGTGATGACGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002359.2-776s21c1
Sequence:CCGGTGTTTCCTTCTCTTCTCTTTCCTCGAGGAAAGAGAAGAGAAGGAAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002359.2-509s21c1
Sequence:CCGGAGCATGAAGCTGGAGCTCGACCTCGAGGTCGAGCTCCAGCTTCATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002359.2-356s21c1
Sequence:CCGGGAGATCGTCCAGCTGAAGCAGCTCGAGCTGCTTCAGCTGGACGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002359.1-478s1c1
Sequence:CCGGCCTCAGAGAACGCCAGCATGACTCGAGTCATGCTGGCGTTCTCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002359.1-1368s1c1
Sequence:CCGGCACTGTTTACATGACCTATTTCTCGAGAAATAGGTCATGTAAACAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002359.2-672s21c1
Sequence:CCGGTAGTAAAGTCCAAGACGGATGCTCGAGCATCCGTCTTGGACTTTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002359
MAFG MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog G
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002359.1-326s1c1
Sequence:CCGGCCTGTCCAAGGAGGAGATCGTCTCGAGACGATCTCCTCCTTGGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002359.1-640s1c1
Sequence:CCGGCCAGCGTCATCACAATAGTAACTCGAGTTACTATTGTGATGACGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002359.2-776s21c1
Sequence:CCGGTGTTTCCTTCTCTTCTCTTTCCTCGAGGAAAGAGAAGAGAAGGAAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002359.2-509s21c1
Sequence:CCGGAGCATGAAGCTGGAGCTCGACCTCGAGGTCGAGCTCCAGCTTCATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002359.2-356s21c1
Sequence:CCGGGAGATCGTCCAGCTGAAGCAGCTCGAGCTGCTTCAGCTGGACGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002359.1-478s1c1
Sequence:CCGGCCTCAGAGAACGCCAGCATGACTCGAGTCATGCTGGCGTTCTCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002359.1-1368s1c1
Sequence:CCGGCACTGTTTACATGACCTATTTCTCGAGAAATAGGTCATGTAAACAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002359.2-672s21c1
Sequence:CCGGTAGTAAAGTCCAAGACGGATGCTCGAGCATCCGTCTTGGACTTTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002359
MAFG MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog G
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002359.1-326s1c1
Sequence:CCGGCCTGTCCAAGGAGGAGATCGTCTCGAGACGATCTCCTCCTTGGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002359.1-640s1c1
Sequence:CCGGCCAGCGTCATCACAATAGTAACTCGAGTTACTATTGTGATGACGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002359.2-776s21c1
Sequence:CCGGTGTTTCCTTCTCTTCTCTTTCCTCGAGGAAAGAGAAGAGAAGGAAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002359.2-509s21c1
Sequence:CCGGAGCATGAAGCTGGAGCTCGACCTCGAGGTCGAGCTCCAGCTTCATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002359.2-356s21c1
Sequence:CCGGGAGATCGTCCAGCTGAAGCAGCTCGAGCTGCTTCAGCTGGACGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002359.1-478s1c1
Sequence:CCGGCCTCAGAGAACGCCAGCATGACTCGAGTCATGCTGGCGTTCTCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002359.1-1368s1c1
Sequence:CCGGCACTGTTTACATGACCTATTTCTCGAGAAATAGGTCATGTAAACAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002359.2-672s21c1
Sequence:CCGGTAGTAAAGTCCAAGACGGATGCTCGAGCATCCGTCTTGGACTTTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010756
VALIDATED
MAFG MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog G
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010756.3-768s1c1
Sequence:CCGGCCGTCCCTCTTCCTTTCATTTCTCGAGAAATGAAAGGAAGAGGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010756.3-681s1c1
Sequence:CCGGCCAAGACGGATGCTCGGTCATCTCGAGATGACCGAGCATCCGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010756.3-316s1c1
Sequence:CCGGGCGAGAGTTGAACCAGCACCTCTCGAGAGGTGCTGGTTCAACTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010756.3-656s1c1
Sequence:CCGGACCAGCGTCATCACAATAGTACTCGAGTACTATTGTGATGACGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010756.3-664s1c1
Sequence:CCGGCATCACAATAGTAAAGTCCAACTCGAGTTGGACTTTACTATTGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-682s21c1
Sequence:CCGGCAAGACGGATGCTCGGTCATACTCGAGTATGACCGAGCATCCGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-486s21c1
Sequence:CCGGAGAAGCTGGCCTCGGAGAATGCTCGAGCATTCTCCGAGGCCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010756.3-878s21c1
Sequence:CCGGTCGTTGTCACGCCTGTGTTTCCTCGAGGAAACACAGGCGTGACAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-658s21c1
Sequence:CCGGCAGCGTCATCACAATAGTAAACTCGAGTTTACTATTGTGATGACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-423s21c1
Sequence:CCGGTCAAGCGGGTGACACAGAAGGCTCGAGCCTTCTGTGTCACCCGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-285s21c1
Sequence:CCGGTGACCGACGAGGAGCTGGTAACTCGAGTTACCAGCTCCTCGTCGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-545s21c1
Sequence:CCGGTACGAGGCCCTGCAGAACTTTCTCGAGAAAGTTCTGCAGGGCCTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010756.3-925s21c1
Sequence:CCGGGTGATGTTGGGTTGCCCTTAACTCGAGTTAAGGGCAACCCAACATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010756
VALIDATED
MAFG MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog G
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010756.3-768s1c1
Sequence:CCGGCCGTCCCTCTTCCTTTCATTTCTCGAGAAATGAAAGGAAGAGGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010756.3-681s1c1
Sequence:CCGGCCAAGACGGATGCTCGGTCATCTCGAGATGACCGAGCATCCGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010756.3-316s1c1
Sequence:CCGGGCGAGAGTTGAACCAGCACCTCTCGAGAGGTGCTGGTTCAACTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010756.3-656s1c1
Sequence:CCGGACCAGCGTCATCACAATAGTACTCGAGTACTATTGTGATGACGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010756.3-664s1c1
Sequence:CCGGCATCACAATAGTAAAGTCCAACTCGAGTTGGACTTTACTATTGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-682s21c1
Sequence:CCGGCAAGACGGATGCTCGGTCATACTCGAGTATGACCGAGCATCCGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-486s21c1
Sequence:CCGGAGAAGCTGGCCTCGGAGAATGCTCGAGCATTCTCCGAGGCCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010756.3-878s21c1
Sequence:CCGGTCGTTGTCACGCCTGTGTTTCCTCGAGGAAACACAGGCGTGACAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-658s21c1
Sequence:CCGGCAGCGTCATCACAATAGTAAACTCGAGTTTACTATTGTGATGACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-423s21c1
Sequence:CCGGTCAAGCGGGTGACACAGAAGGCTCGAGCCTTCTGTGTCACCCGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-285s21c1
Sequence:CCGGTGACCGACGAGGAGCTGGTAACTCGAGTTACCAGCTCCTCGTCGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-545s21c1
Sequence:CCGGTACGAGGCCCTGCAGAACTTTCTCGAGAAAGTTCTGCAGGGCCTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010756.3-925s21c1
Sequence:CCGGGTGATGTTGGGTTGCCCTTAACTCGAGTTAAGGGCAACCCAACATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010756
VALIDATED
MAFG MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog G
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010756.3-768s1c1
Sequence:CCGGCCGTCCCTCTTCCTTTCATTTCTCGAGAAATGAAAGGAAGAGGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010756.3-681s1c1
Sequence:CCGGCCAAGACGGATGCTCGGTCATCTCGAGATGACCGAGCATCCGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010756.3-316s1c1
Sequence:CCGGGCGAGAGTTGAACCAGCACCTCTCGAGAGGTGCTGGTTCAACTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010756.3-656s1c1
Sequence:CCGGACCAGCGTCATCACAATAGTACTCGAGTACTATTGTGATGACGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010756.3-664s1c1
Sequence:CCGGCATCACAATAGTAAAGTCCAACTCGAGTTGGACTTTACTATTGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-682s21c1
Sequence:CCGGCAAGACGGATGCTCGGTCATACTCGAGTATGACCGAGCATCCGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-486s21c1
Sequence:CCGGAGAAGCTGGCCTCGGAGAATGCTCGAGCATTCTCCGAGGCCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010756.3-878s21c1
Sequence:CCGGTCGTTGTCACGCCTGTGTTTCCTCGAGGAAACACAGGCGTGACAACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-658s21c1
Sequence:CCGGCAGCGTCATCACAATAGTAAACTCGAGTTTACTATTGTGATGACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-423s21c1
Sequence:CCGGTCAAGCGGGTGACACAGAAGGCTCGAGCCTTCTGTGTCACCCGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-285s21c1
Sequence:CCGGTGACCGACGAGGAGCTGGTAACTCGAGTTACCAGCTCCTCGTCGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010756.3-545s21c1
Sequence:CCGGTACGAGGCCCTGCAGAACTTTCTCGAGAAAGTTCTGCAGGGCCTCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010756.3-925s21c1
Sequence:CCGGGTGATGTTGGGTTGCCCTTAACTCGAGTTAAGGGCAACCCAACATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)