EMAIL THIS PAGE TO A FRIEND

MAFK

v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog K

107 Gene Product Result for
Synonyms: NFE2U P18
UniProtKB ID: O60675
Gene ID:
Human(7975) Summary: The developmentally regulated expression of the globin genes depends on upstream regulatory elements termed locus control regions (LCRs). LCRs are associated with powerful enhancer activity that is mediated by the transcription factor NFE2 (nuclear factor erythroid-2). NFE2 recognition sites are also present in the gene promoters of 2 heme biosynthetic enzymes, porphobilinogen deaminase (PBGD; MIM 609806) and ferrochelatase (FECH; MIM 612386). NFE2 DNA-binding activity consists of a heterodimer containing an 18-kD Maf protein (MafF, MafG (MIM 602020), or MafK) and p45 (MIM 601490). Both subunits are members of the activator protein-1 superfamily of basic leucine zipper (bZIP) proteins (see MIM 165160). Maf homodimers suppress transcription at NFE2 sites.[supplied by OMIM, Nov 2008]
Mouse(17135) v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian)
Rat(246760) v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog K
Zebrafish(415133) v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian)
dog(100685400) v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian)
cow(618914) v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian)
domestic cat(101089820) v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian)
chicken(395518) v-maf musculoaponeurotic fibrosarcoma oncogene homolog K
domestic guinea pig(100735555) v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian)
naked mole-rat(101707776) v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300084 Anti-MAFK (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AV47559 Anti-MAFK antibody produced in rabbit IgG fraction of antiserum , canine, zebrafish, rabbit, horse, guinea pig, human, rat, mouse, sheep, bovine
western blot pricing
SAB2106777 Anti-MAFK antibody produced in rabbit affinity isolated antibody guinea pig, mouse, human
western blot pricing
HPA060841 Anti-MAFK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU044131 MISSION® esiRNA esiRNA targeting mouse Mafk (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002360 Rosetta Predictions human pricing
NM_145673 Rosetta Predictions rat pricing
NM_010757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031369 predicted 409
2 SASI_Hs01_00031370 predicted 357
3 SASI_Hs01_00031371 predicted 212
4 SASI_Hs01_00031372 predicted 223
5 SASI_Hs01_00031373 predicted 925
6 SASI_Hs01_00031374 predicted 828
7 SASI_Hs01_00031375 predicted 767
8 SASI_Hs01_00031376 predicted 754
9 SASI_Hs01_00031377 predicted 481
10 SASI_Hs01_00031378 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056159 predicted 391
2 SASI_Rn01_00056161 predicted 591
3 SASI_Rn01_00056162 predicted 953
4 SASI_Rn01_00056164 predicted 1092
5 SASI_Rn01_00056166 predicted 947
6 SASI_Rn02_00268719 predicted 1125
7 SASI_Rn01_00056167 predicted 460
8 SASI_Rn02_00268720 predicted 591
9 SASI_Rn01_00056168 predicted 1022
10 SASI_Rn02_00268721 predicted 530
11 SASI_Rn01_00056160 predicted 971
12 SASI_Rn01_00056163 predicted 1121
13 SASI_Rn01_00056165 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044694 predicted 218
2 SASI_Mm01_00044695 predicted 1150
3 SASI_Mm01_00044696 predicted 544
4 SASI_Mm02_00319277 predicted 1073
5 SASI_Mm01_00044697 predicted 422
6 SASI_Mm01_00044698 predicted 540
7 SASI_Mm01_00044699 predicted 1128
8 SASI_Mm01_00044700 predicted 866
9 SASI_Mm01_00044702 predicted 943
10 SASI_Mm01_00044703 predicted 514
11 SASI_Mm01_00044701 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002360
VALIDATED
MAFK MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog K
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002360.3-286s21c1
Sequence:CCGGCGATGATGAGCTGGTGTCCATCTCGAGATGGACACCAGCTCATCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002360.3-418s21c1
Sequence:CCGGCATCAAGCGGGTGACGCAGAACTCGAGTTCTGCGTCACCCGCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002360.3-2471s21c1
Sequence:CCGGCCGTGGTAGGTAATCCATATTCTCGAGAATATGGATTACCTACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002360.3-664s21c1
Sequence:CCGGCTTCTCGGCTGCATCCTAGTGCTCGAGCACTAGGATGCAGCCGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002360.3-625s21c1
Sequence:CCGGCATCGTCAAGTCCACCGAGCTCTCGAGAGCTCGGTGGACTTGACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-340s1c1
Sequence:CCGGGTCTCACCAAGGAGGAGGTGACTCGAGTCACCTCCTCCTTGGTGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-626s1c1
Sequence:CCGGCATCGTCAAGTCCACCGAGCTCTCGAGAGCTCGGTGGACTTGACGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-492s1c1
Sequence:CCGGGCGCGTGAGAACAGCAGCATGCTCGAGCATGCTGCTGTTCTCACGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-275s1c1
Sequence:CCGGCCCGGTGCTCAGCGATGATGACTCGAGTCATCATCGCTGAGCACCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002360.1-829s1c1
Sequence:CCGGGAGACTGTATTGCAGGGTGAACTCGAGTTCACCCTGCAATACAGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002360
VALIDATED
MAFK MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog K
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002360.3-286s21c1
Sequence:CCGGCGATGATGAGCTGGTGTCCATCTCGAGATGGACACCAGCTCATCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002360.3-418s21c1
Sequence:CCGGCATCAAGCGGGTGACGCAGAACTCGAGTTCTGCGTCACCCGCTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002360.3-2471s21c1
Sequence:CCGGCCGTGGTAGGTAATCCATATTCTCGAGAATATGGATTACCTACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002360.3-664s21c1
Sequence:CCGGCTTCTCGGCTGCATCCTAGTGCTCGAGCACTAGGATGCAGCCGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002360.3-625s21c1
Sequence:CCGGCATCGTCAAGTCCACCGAGCTCTCGAGAGCTCGGTGGACTTGACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-340s1c1
Sequence:CCGGGTCTCACCAAGGAGGAGGTGACTCGAGTCACCTCCTCCTTGGTGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-626s1c1
Sequence:CCGGCATCGTCAAGTCCACCGAGCTCTCGAGAGCTCGGTGGACTTGACGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-492s1c1
Sequence:CCGGGCGCGTGAGAACAGCAGCATGCTCGAGCATGCTGCTGTTCTCACGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-275s1c1
Sequence:CCGGCCCGGTGCTCAGCGATGATGACTCGAGTCATCATCGCTGAGCACCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002360.1-829s1c1
Sequence:CCGGGAGACTGTATTGCAGGGTGAACTCGAGTTCACCCTGCAATACAGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002360
VALIDATED
MAFK MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog K
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002360.3-286s21c1
Sequence:CCGGCGATGATGAGCTGGTGTCCATCTCGAGATGGACACCAGCTCATCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002360.3-418s21c1
Sequence:CCGGCATCAAGCGGGTGACGCAGAACTCGAGTTCTGCGTCACCCGCTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002360.3-2471s21c1
Sequence:CCGGCCGTGGTAGGTAATCCATATTCTCGAGAATATGGATTACCTACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002360.3-664s21c1
Sequence:CCGGCTTCTCGGCTGCATCCTAGTGCTCGAGCACTAGGATGCAGCCGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002360.3-625s21c1
Sequence:CCGGCATCGTCAAGTCCACCGAGCTCTCGAGAGCTCGGTGGACTTGACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-340s1c1
Sequence:CCGGGTCTCACCAAGGAGGAGGTGACTCGAGTCACCTCCTCCTTGGTGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-626s1c1
Sequence:CCGGCATCGTCAAGTCCACCGAGCTCTCGAGAGCTCGGTGGACTTGACGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-492s1c1
Sequence:CCGGGCGCGTGAGAACAGCAGCATGCTCGAGCATGCTGCTGTTCTCACGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002360.1-275s1c1
Sequence:CCGGCCCGGTGCTCAGCGATGATGACTCGAGTCATCATCGCTGAGCACCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002360.1-829s1c1
Sequence:CCGGGAGACTGTATTGCAGGGTGAACTCGAGTTCACCCTGCAATACAGTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010757
VALIDATED
MAFK MISSION shRNA Bacterial Glycerol Stock
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog K
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010757.2-301s21c1
Sequence:CCGGATGAGCTGGTGTCCATGTCAGCTCGAGCTGACATGGACACCAGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010757.2-548s21c1
Sequence:CCGGCAAGTATGAGGCCCTACAGACCTCGAGGTCTGTAGGGCCTCATACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010757.2-628s21c1
Sequence:CCGGTCATCACCATCGTCAAATCTGCTCGAGCAGATTTGACGATGGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010757.2-430s21c1
Sequence:CCGGTCAAGCGTGTGACACAGAAAGCTCGAGCTTTCTGTGTCACACGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010757.2-1901s21c1
Sequence:CCGGCAATAAGGACCATGGATATTTCTCGAGAAATATCCATGGTCCTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010757.1-1698s1c1
Sequence:CCGGCCCACTTGTTACCTAAGCCTTCTCGAGAAGGCTTAGGTAACAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010757.1-546s1c1
Sequence:CCGGCGCTCCAAGTATGAGGCCCTACTCGAGTAGGGCCTCATACTTGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010757.1-293s1c1
Sequence:CCGGTCTTAGCGATGATGAGCTGGTCTCGAGACCAGCTCATCATCGCTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010757.1-619s1c1
Sequence:CCGGCCACCACCAGTGTCATCACCACTCGAGTGGTGATGACACTGGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010757
VALIDATED
MAFK MISSION shRNA shRNA Plasmid DNA
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog K
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010757.2-301s21c1
Sequence:CCGGATGAGCTGGTGTCCATGTCAGCTCGAGCTGACATGGACACCAGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010757.2-548s21c1
Sequence:CCGGCAAGTATGAGGCCCTACAGACCTCGAGGTCTGTAGGGCCTCATACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010757.2-628s21c1
Sequence:CCGGTCATCACCATCGTCAAATCTGCTCGAGCAGATTTGACGATGGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010757.2-430s21c1
Sequence:CCGGTCAAGCGTGTGACACAGAAAGCTCGAGCTTTCTGTGTCACACGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010757.2-1901s21c1
Sequence:CCGGCAATAAGGACCATGGATATTTCTCGAGAAATATCCATGGTCCTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010757.1-1698s1c1
Sequence:CCGGCCCACTTGTTACCTAAGCCTTCTCGAGAAGGCTTAGGTAACAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010757.1-546s1c1
Sequence:CCGGCGCTCCAAGTATGAGGCCCTACTCGAGTAGGGCCTCATACTTGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010757.1-293s1c1
Sequence:CCGGTCTTAGCGATGATGAGCTGGTCTCGAGACCAGCTCATCATCGCTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010757.1-619s1c1
Sequence:CCGGCCACCACCAGTGTCATCACCACTCGAGTGGTGATGACACTGGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010757
VALIDATED
MAFK MISSION shRNA Lentiviral Transduction Particles
v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog K
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010757.2-301s21c1
Sequence:CCGGATGAGCTGGTGTCCATGTCAGCTCGAGCTGACATGGACACCAGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010757.2-548s21c1
Sequence:CCGGCAAGTATGAGGCCCTACAGACCTCGAGGTCTGTAGGGCCTCATACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010757.2-628s21c1
Sequence:CCGGTCATCACCATCGTCAAATCTGCTCGAGCAGATTTGACGATGGTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010757.2-430s21c1
Sequence:CCGGTCAAGCGTGTGACACAGAAAGCTCGAGCTTTCTGTGTCACACGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010757.2-1901s21c1
Sequence:CCGGCAATAAGGACCATGGATATTTCTCGAGAAATATCCATGGTCCTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010757.1-1698s1c1
Sequence:CCGGCCCACTTGTTACCTAAGCCTTCTCGAGAAGGCTTAGGTAACAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010757.1-546s1c1
Sequence:CCGGCGCTCCAAGTATGAGGCCCTACTCGAGTAGGGCCTCATACTTGGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010757.1-293s1c1
Sequence:CCGGTCTTAGCGATGATGAGCTGGTCTCGAGACCAGCTCATCATCGCTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010757.1-619s1c1
Sequence:CCGGCCACCACCAGTGTCATCACCACTCGAGTGGTGATGACACTGGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)