EMAIL THIS PAGE TO A FRIEND

MAG

myelin associated glycoprotein

65 Gene Product Result for
Synonyms: GMA S-MAG SIGLEC-4A SIGLEC4A
UniProtKB ID: P20916, B7Z2E5, F5GYC0, Q567S4
Gene ID:
Human(4099) Summary: The protein encoded by this gene is a type I membrane protein and member of the immunoglobulin superfamily. It is thought to be involved in the process of myelination. It is a lectin that binds to sialylated glycoconjugates and mediates certain myelin-neuron cell-cell interactions. Three alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Nov 2010]
Mouse(17136) myelin-associated glycoprotein
Rat(29409) myelin-associated glycoprotein
naked mole-rat(101697784) myelin associated glycoprotein
domestic guinea pig(100735905) myelin associated glycoprotein
sheep(101116672) myelin associated glycoprotein
Zebrafish(474346) myelin associated glycoprotein
domestic cat(101101525) myelin associated glycoprotein
cow(540576) myelin associated glycoprotein
Horse(100050806) myelin associated glycoprotein
dog(611884) myelin associated glycoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0908 Rat Mag / Myelin-associated Glycoprotein ELISA Kit rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002361 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141201 MISSION® esiRNA esiRNA human MAG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002361 Rosetta Predictions human pricing
NM_080600 Rosetta Predictions human pricing
NM_017190 Rosetta Predictions rat pricing
NM_010758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118856 predicted 1168
2 SASI_Hs01_00118857 predicted 619
3 SASI_Hs01_00118858 predicted 1067
4 SASI_Hs01_00118859 predicted 1492
5 SASI_Hs01_00118860 predicted 825
6 SASI_Hs01_00118861 predicted 1194
7 SASI_Hs01_00118862 predicted 1520
8 SASI_Hs01_00118863 predicted 316
9 SASI_Hs02_00333702 predicted 361
10 SASI_Hs01_00118865 predicted 1422
11 SASI_Hs01_00118864 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016466 predicted 1175
2 SASI_Hs01_00016467 predicted 614
3 SASI_Hs01_00016468 predicted 1066
4 SASI_Hs01_00016469 predicted 1494
5 SASI_Hs01_00016470 predicted 818
6 SASI_Hs01_00016471 predicted 1194
7 SASI_Hs01_00016472 predicted 1520
8 SASI_Hs01_00016473 predicted 311
9 SASI_Hs02_00362337 predicted 366
10 SASI_Hs01_00016475 predicted 1416
11 SASI_Hs01_00016474 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058924 predicted 882
2 SASI_Rn01_00058925 predicted 835
3 SASI_Rn01_00058926 predicted 510
4 SASI_Rn01_00058927 predicted 2111
5 SASI_Rn02_00261537 predicted 1350
6 SASI_Rn01_00058928 predicted 1121
7 SASI_Rn01_00058929 predicted 1811
8 SASI_Rn01_00058930 predicted 1927
9 SASI_Rn01_00058932 predicted 527
10 SASI_Rn01_00058933 predicted 390
11 SASI_Rn01_00058931 predicted 1848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106434 predicted 1514
2 SASI_Mm01_00106435 predicted 2033
3 SASI_Mm01_00106436 predicted 618
4 SASI_Mm01_00106437 predicted 1961
5 SASI_Mm01_00106439 predicted 1799
6 SASI_Mm02_00319278 predicted 838
7 SASI_Mm01_00106440 predicted 1487
8 SASI_Mm02_00319279 predicted 294
9 SASI_Mm02_00319280 predicted 302
10 SASI_Mm01_00106441 predicted 2024
11 SASI_Mm01_00106432 predicted 1730
12 SASI_Mm01_00106433 predicted 872
13 SASI_Mm01_00106438 predicted 843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010758
MAG MISSION shRNA Bacterial Glycerol Stock
myelin associated glycoprotein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010758.1-2148s1c1
Sequence:CCGGGCTCCCTTTCTCTTGAGAGTACTCGAGTACTCTCAAGAGAAAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-1434s1c1
Sequence:CCGGGCAGTGTCTATGTGTGGTAAACTCGAGTTTACCACACATAGACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-324s1c1
Sequence:CCGGCTGGTATTTCAATAGTCCCTACTCGAGTAGGGACTATTGAAATACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-752s1c1
Sequence:CCGGTGCTACACTTCGTGCCTACTACTCGAGTAGTAGGCACGAAGTGTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-1605s1c1
Sequence:CCGGCGTCATTTGTACCTCCAGGAACTCGAGTTCCTGGAGGTACAAATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010758
MAG MISSION shRNA shRNA Plasmid DNA
myelin associated glycoprotein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010758.1-2148s1c1
Sequence:CCGGGCTCCCTTTCTCTTGAGAGTACTCGAGTACTCTCAAGAGAAAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-1434s1c1
Sequence:CCGGGCAGTGTCTATGTGTGGTAAACTCGAGTTTACCACACATAGACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-324s1c1
Sequence:CCGGCTGGTATTTCAATAGTCCCTACTCGAGTAGGGACTATTGAAATACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-752s1c1
Sequence:CCGGTGCTACACTTCGTGCCTACTACTCGAGTAGTAGGCACGAAGTGTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-1605s1c1
Sequence:CCGGCGTCATTTGTACCTCCAGGAACTCGAGTTCCTGGAGGTACAAATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010758
MAG MISSION shRNA Lentiviral Transduction Particles
myelin associated glycoprotein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010758.1-2148s1c1
Sequence:CCGGGCTCCCTTTCTCTTGAGAGTACTCGAGTACTCTCAAGAGAAAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-1434s1c1
Sequence:CCGGGCAGTGTCTATGTGTGGTAAACTCGAGTTTACCACACATAGACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-324s1c1
Sequence:CCGGCTGGTATTTCAATAGTCCCTACTCGAGTAGGGACTATTGAAATACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-752s1c1
Sequence:CCGGTGCTACACTTCGTGCCTACTACTCGAGTAGTAGGCACGAAGTGTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010758.1-1605s1c1
Sequence:CCGGCGTCATTTGTACCTCCAGGAACTCGAGTTCCTGGAGGTACAAATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002361
MAG MISSION shRNA Bacterial Glycerol Stock
myelin associated glycoprotein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002361.2-1995s1c1
Sequence:CCGGGAGCTAGCTGAGTATGCTGAACTCGAGTTCAGCATACTCAGCTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002361.2-1361s1c1
Sequence:CCGGCTTCAACCTGTCTGTGGAGTTCTCGAGAACTCCACAGACAGGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002361.2-1997s1c1
Sequence:CCGGGCTAGCTGAGTATGCTGAAATCTCGAGATTTCAGCATACTCAGCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1324s21c1
Sequence:CCGGGTGTGGCTGAGAACCAGTATGCTCGAGCATACTGGTTCTCAGCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1729s21c1
Sequence:CCGGTTGCCATCGTCTGCTACATTACTCGAGTAATGTAGCAGACGATGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1134s21c1
Sequence:CCGGCCAACAGTGAACGGGACAATGCTCGAGCATTGTCCCGTTCACTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-316s21c1
Sequence:CCGGATGGTGTCTGGTACTTCAATACTCGAGTATTGAAGTACCAGACACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1997s21c1
Sequence:CCGGGCTAGCTGAGTATGCTGAAATCTCGAGATTTCAGCATACTCAGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002361
MAG MISSION shRNA shRNA Plasmid DNA
myelin associated glycoprotein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002361.2-1995s1c1
Sequence:CCGGGAGCTAGCTGAGTATGCTGAACTCGAGTTCAGCATACTCAGCTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002361.2-1361s1c1
Sequence:CCGGCTTCAACCTGTCTGTGGAGTTCTCGAGAACTCCACAGACAGGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002361.2-1997s1c1
Sequence:CCGGGCTAGCTGAGTATGCTGAAATCTCGAGATTTCAGCATACTCAGCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1324s21c1
Sequence:CCGGGTGTGGCTGAGAACCAGTATGCTCGAGCATACTGGTTCTCAGCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1729s21c1
Sequence:CCGGTTGCCATCGTCTGCTACATTACTCGAGTAATGTAGCAGACGATGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1134s21c1
Sequence:CCGGCCAACAGTGAACGGGACAATGCTCGAGCATTGTCCCGTTCACTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-316s21c1
Sequence:CCGGATGGTGTCTGGTACTTCAATACTCGAGTATTGAAGTACCAGACACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1997s21c1
Sequence:CCGGGCTAGCTGAGTATGCTGAAATCTCGAGATTTCAGCATACTCAGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002361
MAG MISSION shRNA Lentiviral Transduction Particles
myelin associated glycoprotein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002361.2-1995s1c1
Sequence:CCGGGAGCTAGCTGAGTATGCTGAACTCGAGTTCAGCATACTCAGCTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002361.2-1361s1c1
Sequence:CCGGCTTCAACCTGTCTGTGGAGTTCTCGAGAACTCCACAGACAGGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002361.2-1997s1c1
Sequence:CCGGGCTAGCTGAGTATGCTGAAATCTCGAGATTTCAGCATACTCAGCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1324s21c1
Sequence:CCGGGTGTGGCTGAGAACCAGTATGCTCGAGCATACTGGTTCTCAGCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1729s21c1
Sequence:CCGGTTGCCATCGTCTGCTACATTACTCGAGTAATGTAGCAGACGATGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1134s21c1
Sequence:CCGGCCAACAGTGAACGGGACAATGCTCGAGCATTGTCCCGTTCACTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-316s21c1
Sequence:CCGGATGGTGTCTGGTACTTCAATACTCGAGTATTGAAGTACCAGACACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002361.2-1997s21c1
Sequence:CCGGGCTAGCTGAGTATGCTGAAATCTCGAGATTTCAGCATACTCAGCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)