EMAIL THIS PAGE TO A FRIEND

MAGEA10

melanoma antigen family A, 10

81 Gene Product Result for
Synonyms: CT1.10 MAGE10
UniProtKB ID: P43363
Gene ID:
Human(4109) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream melanoma antigen family A, 5 (MAGEA5) gene.[provided by RefSeq, Oct 2011]
Mouse(236852) melanoma antigen family A, 10
Rat(293832) melanoma antigen family A, 10
cow(509805) melanoma antigen family A, 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021048 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036501 MISSION® esiRNA esiRNA human MAGEA10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011543 Rosetta Predictions human pricing
NM_021048 Rosetta Predictions human pricing
XM_219709 Rosetta Predictions rat pricing
XR_007284 Rosetta Predictions rat pricing
NM_001085506 Rosetta Predictions mouse pricing
XM_141834 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127255 predicted 909
2 SASI_Hs01_00127256 predicted 1328
3 SASI_Hs01_00127257 predicted 1323
4 SASI_Hs01_00127258 predicted 841
5 SASI_Hs01_00127259 predicted 1311
6 SASI_Hs01_00127263 predicted 1068
7 SASI_Hs01_00127264 predicted 1327
8 SASI_Hs02_00305975 predicted 1268
9 SASI_Hs02_00305976 predicted 1266
10 SASI_Hs02_00305977 predicted 832
11 SASI_Hs01_00127260 predicted 922
12 SASI_Hs01_00127261 predicted 1185
13 SASI_Hs01_00127262 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023753 predicted 817
2 SASI_Hs01_00023754 predicted 1236
3 SASI_Hs01_00023755 predicted 1229
4 SASI_Hs01_00023756 predicted 744
5 SASI_Hs01_00023757 predicted 1214
6 SASI_Hs01_00023761 predicted 979
7 SASI_Hs01_00023762 predicted 1235
8 SASI_Hs02_00354528 predicted 1173
9 SASI_Hs02_00354529 predicted 1175
10 SASI_Hs02_00354530 predicted 744
11 SASI_Hs01_00023758 predicted 837
12 SASI_Hs01_00023759 predicted 1095
13 SASI_Hs01_00023760 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144772 predicted 596
2 SASI_Rn01_00144773 predicted 459
3 SASI_Rn01_00144774 predicted 575
4 SASI_Rn01_00144775 predicted 461
5 SASI_Rn01_00144776 predicted 539
6 SASI_Rn01_00144777 predicted 659
7 SASI_Rn01_00144778 predicted 645
8 SASI_Rn01_00144779 predicted 625
9 SASI_Rn01_00144780 predicted 665
10 SASI_Rn01_00144781 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168594 predicted 611
2 SASI_Rn01_00168595 predicted 729
3 SASI_Rn01_00168596 predicted 609
4 SASI_Rn01_00168597 predicted 682
5 SASI_Rn01_00168598 predicted 813
6 SASI_Rn02_00414220 predicted 574
7 SASI_Rn01_00168600 predicted 776
8 SASI_Rn01_00168602 predicted 808
9 SASI_Rn02_00414221 predicted 1034
10 SASI_Rn01_00168603 predicted 691
11 SASI_Rn01_00168599 predicted 807
12 SASI_Rn01_00168601 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300642 predicted 791
2 SASI_Mm02_00300643 predicted 736
3 SASI_Mm02_00300644 predicted 895
4 SASI_Mm02_00300645 predicted 730
5 SASI_Mm02_00300646 predicted 920
6 SASI_Mm02_00300647 predicted 934
7 SASI_Mm02_00300648 predicted 771
8 SASI_Mm02_00300649 predicted 1361
9 SASI_Mm02_00300650 predicted 928
10 SASI_Mm02_00300651 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_141834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211857 predicted 488
2 SASI_Mm01_00211858 predicted 436
3 SASI_Mm01_00211859 predicted 603
4 SASI_Mm01_00211860 predicted 423
5 SASI_Mm01_00211861 predicted 430
6 SASI_Mm01_00211862 predicted 620
7 SASI_Mm01_00211863 predicted 636
8 SASI_Mm01_00211864 predicted 626
9 SASI_Mm01_00211865 predicted 541
10 SASI_Mm01_00211866 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021048
MAGEA10 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-1263s1c1
Sequence:CCGGGCCAAGGTAAATGGGAGTGATCTCGAGATCACTCCCATTTACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-705s1c1
Sequence:CCGGCCCAGAAGTGAGATAGATGAACTCGAGTTCATCTATCTCACTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-996s1c1
Sequence:CCGGCTCATACTTATCCTAAGCATACTCGAGTATGCTTAGGATAAGTATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-776s1c1
Sequence:CCGGGCCGATCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-502s1c1
Sequence:CCGGCCTGCTATCCTCTAATACCAACTCGAGTTGGTATTAGAGGATAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021048.3-1406s21c1
Sequence:CCGGTAGCTTCTCCTACCCTGAATACTCGAGTATTCAGGGTAGGAGAAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021048.3-1186s21c1
Sequence:CCGGATCCTGCACGGTATGAGTTTCCTCGAGGAAACTCATACCGTGCAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021048
MAGEA10 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-1263s1c1
Sequence:CCGGGCCAAGGTAAATGGGAGTGATCTCGAGATCACTCCCATTTACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-705s1c1
Sequence:CCGGCCCAGAAGTGAGATAGATGAACTCGAGTTCATCTATCTCACTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-996s1c1
Sequence:CCGGCTCATACTTATCCTAAGCATACTCGAGTATGCTTAGGATAAGTATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-776s1c1
Sequence:CCGGGCCGATCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-502s1c1
Sequence:CCGGCCTGCTATCCTCTAATACCAACTCGAGTTGGTATTAGAGGATAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021048.3-1406s21c1
Sequence:CCGGTAGCTTCTCCTACCCTGAATACTCGAGTATTCAGGGTAGGAGAAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021048.3-1186s21c1
Sequence:CCGGATCCTGCACGGTATGAGTTTCCTCGAGGAAACTCATACCGTGCAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021048
MAGEA10 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-1263s1c1
Sequence:CCGGGCCAAGGTAAATGGGAGTGATCTCGAGATCACTCCCATTTACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-705s1c1
Sequence:CCGGCCCAGAAGTGAGATAGATGAACTCGAGTTCATCTATCTCACTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-996s1c1
Sequence:CCGGCTCATACTTATCCTAAGCATACTCGAGTATGCTTAGGATAAGTATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-776s1c1
Sequence:CCGGGCCGATCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021048.3-502s1c1
Sequence:CCGGCCTGCTATCCTCTAATACCAACTCGAGTTGGTATTAGAGGATAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021048.3-1406s21c1
Sequence:CCGGTAGCTTCTCCTACCCTGAATACTCGAGTATTCAGGGTAGGAGAAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021048.3-1186s21c1
Sequence:CCGGATCCTGCACGGTATGAGTTTCCTCGAGGAAACTCATACCGTGCAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085506
MAGEA10 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-1215s21c1
Sequence:CCGGGGAGTGATCCTAGATCATTTCCTCGAGGAAATGATCTAGGATCACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-985s21c1
Sequence:CCGGGGACATGGTATGGAGTATATTCTCGAGAATATACTCCATACCATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-842s21c1
Sequence:CCGGCCTGCTAGCCACACCTATATCCTCGAGGATATAGGTGTGGCTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085506.1-1651s21c1
Sequence:CCGGCATGGTGTTGGGATTAGTATTCTCGAGAATACTAATCCCAACACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-688s21c1
Sequence:CCGGTCTGCTCCTTAAGTATCTTATCTCGAGATAAGATACTTAAGGAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085506
MAGEA10 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-1215s21c1
Sequence:CCGGGGAGTGATCCTAGATCATTTCCTCGAGGAAATGATCTAGGATCACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-985s21c1
Sequence:CCGGGGACATGGTATGGAGTATATTCTCGAGAATATACTCCATACCATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-842s21c1
Sequence:CCGGCCTGCTAGCCACACCTATATCCTCGAGGATATAGGTGTGGCTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085506.1-1651s21c1
Sequence:CCGGCATGGTGTTGGGATTAGTATTCTCGAGAATACTAATCCCAACACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-688s21c1
Sequence:CCGGTCTGCTCCTTAAGTATCTTATCTCGAGATAAGATACTTAAGGAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085506
MAGEA10 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-1215s21c1
Sequence:CCGGGGAGTGATCCTAGATCATTTCCTCGAGGAAATGATCTAGGATCACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-985s21c1
Sequence:CCGGGGACATGGTATGGAGTATATTCTCGAGAATATACTCCATACCATGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-842s21c1
Sequence:CCGGCCTGCTAGCCACACCTATATCCTCGAGGATATAGGTGTGGCTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085506.1-1651s21c1
Sequence:CCGGCATGGTGTTGGGATTAGTATTCTCGAGAATACTAATCCCAACACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085506.1-688s21c1
Sequence:CCGGTCTGCTCCTTAAGTATCTTATCTCGAGATAAGATACTTAAGGAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)