EMAIL THIS PAGE TO A FRIEND

MAGEA11

melanoma antigen family A, 11

52 Gene Product Result for
Synonyms: CT1.11 MAGE-11 MAGE11 MAGEA-11
UniProtKB ID: P43364, Q5ETU4, Q6ZRZ5
Gene ID:
Human(4110) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(302845) melanoma antigen family A, 11
cow(519325) melanoma antigen family A, 11
dog(492218) melanoma antigen family A, 11
dog(492173) melanoma antigen family A, 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005366 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135101 MISSION® esiRNA esiRNA human MAGEA11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011544 Rosetta Predictions human pricing
NM_005366 Rosetta Predictions human pricing
NM_001013962 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305978 predicted 1297
2 SASI_Hs01_00089329 predicted 724
3 SASI_Hs01_00089330 predicted 766
4 SASI_Hs01_00089331 predicted 1420
5 SASI_Hs01_00089333 predicted 569
6 SASI_Hs01_00089334 predicted 868
7 SASI_Hs01_00089335 predicted 562
8 SASI_Hs01_00089336 predicted 879
9 SASI_Hs01_00089338 predicted 901
10 SASI_Hs02_00305979 predicted 1298
11 SASI_Hs01_00089332 predicted 1053
12 SASI_Hs01_00089337 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339455 predicted 1295
2 SASI_Hs01_00165596 predicted 730
3 SASI_Hs01_00165597 predicted 772
4 SASI_Hs01_00165598 predicted 1416
5 SASI_Hs01_00165600 predicted 571
6 SASI_Hs01_00165601 predicted 873
7 SASI_Hs01_00165602 predicted 556
8 SASI_Hs01_00165603 predicted 883
9 SASI_Hs01_00165605 predicted 901
10 SASI_Hs02_00339456 predicted 1293
11 SASI_Hs01_00165599 predicted 1050
12 SASI_Hs01_00165604 predicted 1458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108804 predicted 1050
2 SASI_Rn01_00108805 predicted 520
3 SASI_Rn01_00108806 predicted 591
4 SASI_Rn01_00108807 predicted 1271
5 SASI_Rn01_00108808 predicted 451
6 SASI_Rn01_00108809 predicted 1187
7 SASI_Rn01_00108810 predicted 634
8 SASI_Rn01_00108811 predicted 899
9 SASI_Rn01_00108812 predicted 500
10 SASI_Rn01_00108813 predicted 881
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005366
MAGEA11 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 11
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005366.4-997s21c1
Sequence:CCGGTATGATGGCATACAGTGTAATCTCGAGATTACACTGTATGCCATCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-981s1c1
Sequence:CCGGCTGATAATAGTCCTGGGTGTACTCGAGTACACCCAGGACTATTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005366.4-1666s21c1
Sequence:CCGGTAGTTAGCTTCAACATCTAAGCTCGAGCTTAGATGTTGAAGCTAACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005366.4-1533s21c1
Sequence:CCGGTAGTAGAAGGCACAGTGAATGCTCGAGCATTCACTGTGCCTTCTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005366.4-769s21c1
Sequence:CCGACATGACAAGATAATTGATTTGCTCGAGCAAATCAATTATCTTGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-1271s1c1
Sequence:CCGGCACTTCTTACCCATCCCTGTACTCGAGTACAGGGATGGGTAAGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-807s1c1
Sequence:CCGGGAGGACTACTTTCCTGAGATACTCGAGTATCTCAGGAAAGTAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-1026s1c1
Sequence:CCGGCCTGAAGAGGTTATGTGGGAACTCGAGTTCCCACATAACCTCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-992s1c1
Sequence:CCGGCCTGGGTGTAATCTTCATGGACTCGAGTCCATGAAGATTACACCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-485s1c1
Sequence:CCGGCTTCTTCTCCTCTACTCTGAACTCGAGTTCAGAGTAGAGGAGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-926s1c1
Sequence:CCGGCCTCTCTTATGATGGCATACACTCGAGTGTATGCCATCATAAGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005366
MAGEA11 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 11
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005366.4-997s21c1
Sequence:CCGGTATGATGGCATACAGTGTAATCTCGAGATTACACTGTATGCCATCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-981s1c1
Sequence:CCGGCTGATAATAGTCCTGGGTGTACTCGAGTACACCCAGGACTATTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005366.4-1666s21c1
Sequence:CCGGTAGTTAGCTTCAACATCTAAGCTCGAGCTTAGATGTTGAAGCTAACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005366.4-1533s21c1
Sequence:CCGGTAGTAGAAGGCACAGTGAATGCTCGAGCATTCACTGTGCCTTCTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005366.4-769s21c1
Sequence:CCGACATGACAAGATAATTGATTTGCTCGAGCAAATCAATTATCTTGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-1271s1c1
Sequence:CCGGCACTTCTTACCCATCCCTGTACTCGAGTACAGGGATGGGTAAGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-807s1c1
Sequence:CCGGGAGGACTACTTTCCTGAGATACTCGAGTATCTCAGGAAAGTAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-1026s1c1
Sequence:CCGGCCTGAAGAGGTTATGTGGGAACTCGAGTTCCCACATAACCTCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-992s1c1
Sequence:CCGGCCTGGGTGTAATCTTCATGGACTCGAGTCCATGAAGATTACACCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-485s1c1
Sequence:CCGGCTTCTTCTCCTCTACTCTGAACTCGAGTTCAGAGTAGAGGAGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-926s1c1
Sequence:CCGGCCTCTCTTATGATGGCATACACTCGAGTGTATGCCATCATAAGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005366
MAGEA11 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 11
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005366.4-997s21c1
Sequence:CCGGTATGATGGCATACAGTGTAATCTCGAGATTACACTGTATGCCATCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-981s1c1
Sequence:CCGGCTGATAATAGTCCTGGGTGTACTCGAGTACACCCAGGACTATTATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005366.4-1666s21c1
Sequence:CCGGTAGTTAGCTTCAACATCTAAGCTCGAGCTTAGATGTTGAAGCTAACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005366.4-1533s21c1
Sequence:CCGGTAGTAGAAGGCACAGTGAATGCTCGAGCATTCACTGTGCCTTCTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005366.4-769s21c1
Sequence:CCGACATGACAAGATAATTGATTTGCTCGAGCAAATCAATTATCTTGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-1271s1c1
Sequence:CCGGCACTTCTTACCCATCCCTGTACTCGAGTACAGGGATGGGTAAGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-807s1c1
Sequence:CCGGGAGGACTACTTTCCTGAGATACTCGAGTATCTCAGGAAAGTAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-1026s1c1
Sequence:CCGGCCTGAAGAGGTTATGTGGGAACTCGAGTTCCCACATAACCTCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-992s1c1
Sequence:CCGGCCTGGGTGTAATCTTCATGGACTCGAGTCCATGAAGATTACACCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-485s1c1
Sequence:CCGGCTTCTTCTCCTCTACTCTGAACTCGAGTTCAGAGTAGAGGAGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005366.3-926s1c1
Sequence:CCGGCCTCTCTTATGATGGCATACACTCGAGTGTATGCCATCATAAGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)