EMAIL THIS PAGE TO A FRIEND

MAGEA12

melanoma antigen family A, 12

11 Gene Product Result for
Synonyms: CT1.12 MAGE12
Species: Human MAGEA12(4111)
UniProtKB ID: P43365, Q9NSD3
Gene ID:
Human(4111) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2009]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005367 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005367 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185809 predicted 1004
2 SASI_Hs01_00185810 predicted 365
3 SASI_Hs01_00185811 predicted 1219
4 SASI_Hs01_00185812 predicted 832
5 SASI_Hs01_00185813 predicted 369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005367
MAGEA12 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-365s1c1
Sequence:CCGGCCATCAACTATACTCTCTGGACTCGAGTCCAGAGAGTATAGTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-978s1c1
Sequence:CCGGCGTTGAAACCAGCTATGTGAACTCGAGTTCACATAGCTGGTTTCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005367.5-831s21c1
Sequence:CCGGGAGTGTGTTGGAGGCATCTGACTCGAGTCAGATGCCTCCAACACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-987s1c1
Sequence:CCGGCAGCTATGTGAAAGTCCTGCACTCGAGTGCAGGACTTTCACATAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005367.5-461s21c1
Sequence:CCGCAGACGAGCTTCCAAGTAGCACCTCGAGGTGCTACTTGGAAGCTCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-662s1c1
Sequence:CCGGGCCACTTGTACATCCTTGTCACTCGAGTGACAAGGATGTACAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005367.5-1456s21c1
Sequence:CCGGGACAAATAACAGCAGTGGAAACTCGAGTTTCCACTGCTGTTATTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-369s1c1
Sequence:CCGGCAACTATACTCTCTGGAGTCACTCGAGTGACTCCAGAGAGTATAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-582s1c1
Sequence:CCGGCTTTCCTGTGATCTTCAGCAACTCGAGTTGCTGAAGATCACAGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005367
MAGEA12 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-365s1c1
Sequence:CCGGCCATCAACTATACTCTCTGGACTCGAGTCCAGAGAGTATAGTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-978s1c1
Sequence:CCGGCGTTGAAACCAGCTATGTGAACTCGAGTTCACATAGCTGGTTTCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005367.5-831s21c1
Sequence:CCGGGAGTGTGTTGGAGGCATCTGACTCGAGTCAGATGCCTCCAACACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-987s1c1
Sequence:CCGGCAGCTATGTGAAAGTCCTGCACTCGAGTGCAGGACTTTCACATAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005367.5-461s21c1
Sequence:CCGCAGACGAGCTTCCAAGTAGCACCTCGAGGTGCTACTTGGAAGCTCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-662s1c1
Sequence:CCGGGCCACTTGTACATCCTTGTCACTCGAGTGACAAGGATGTACAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005367.5-1456s21c1
Sequence:CCGGGACAAATAACAGCAGTGGAAACTCGAGTTTCCACTGCTGTTATTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-369s1c1
Sequence:CCGGCAACTATACTCTCTGGAGTCACTCGAGTGACTCCAGAGAGTATAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-582s1c1
Sequence:CCGGCTTTCCTGTGATCTTCAGCAACTCGAGTTGCTGAAGATCACAGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005367
MAGEA12 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-365s1c1
Sequence:CCGGCCATCAACTATACTCTCTGGACTCGAGTCCAGAGAGTATAGTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-978s1c1
Sequence:CCGGCGTTGAAACCAGCTATGTGAACTCGAGTTCACATAGCTGGTTTCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005367.5-831s21c1
Sequence:CCGGGAGTGTGTTGGAGGCATCTGACTCGAGTCAGATGCCTCCAACACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-987s1c1
Sequence:CCGGCAGCTATGTGAAAGTCCTGCACTCGAGTGCAGGACTTTCACATAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005367.5-461s21c1
Sequence:CCGCAGACGAGCTTCCAAGTAGCACCTCGAGGTGCTACTTGGAAGCTCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-662s1c1
Sequence:CCGGGCCACTTGTACATCCTTGTCACTCGAGTGACAAGGATGTACAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005367.5-1456s21c1
Sequence:CCGGGACAAATAACAGCAGTGGAAACTCGAGTTTCCACTGCTGTTATTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-369s1c1
Sequence:CCGGCAACTATACTCTCTGGAGTCACTCGAGTGACTCCAGAGAGTATAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005367.3-582s1c1
Sequence:CCGGCTTTCCTGTGATCTTCAGCAACTCGAGTTGCTGAAGATCACAGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)