EMAIL THIS PAGE TO A FRIEND

MAGEA1

melanoma antigen family A, 1 (directs expression of antigen MZ2-E)

26 Gene Product Result for
Synonyms: CT1.1 MAGE1
UniProtKB ID: P43355, B2RC81, O00346
Gene ID:
Human(4100) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. [provided by RefSeq, Jul 2008]
Mouse(17137) melanoma antigen, family A, 1
Rat(493750) melanoma antigen, family A, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
SRP4820 MAGE-1 human recombinant, expressed in E. coli, ≥90% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004988 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004988 Rosetta Predictions human pricing
NM_020015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165866 predicted 525
2 SASI_Hs01_00165867 predicted 786
3 SASI_Hs01_00165869 predicted 413
4 SASI_Hs01_00165871 predicted 1051
5 SASI_Hs01_00165872 predicted 797
6 SASI_Hs01_00165868 predicted 256
7 SASI_Hs01_00165870 predicted 1045
8 SASI_Hs01_00165874 predicted 1417
9 SASI_Hs01_00165875 predicted 1309
10 SASI_Hs02_00338711 predicted 1270
11 SASI_Hs01_00165873 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068803 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020015
MAGEA1 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 1 (directs expression of antigen MZ2-E)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-141s21c1
Sequence:CCGGGAAACCATGGAGACGTCAGAGCTCGAGCTCTGACGTCTCCATGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-1018s21c1
Sequence:CCGGCATTCTAGTGTATTGGCATTTCTCGAGAAATGCCAATACACTAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-945s21c1
Sequence:CCGGGCTTTGCGAGATGAGATATACCTCGAGGTATATCTCATCTCGCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020015.2-1181s21c1
Sequence:CCGGATCGTAGTATAAGGTCCAATACTCGAGTATTGGACCTTATACTACGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-534s21c1
Sequence:CCGGCCCTCTGTCCACTCCTATATCCTCGAGGATATAGGAGTGGACAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-262s1c1
Sequence:CCGGCCACTTTATTTGTTGCACAATCTCGAGATTGTGCAACAAATAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-611s1c1
Sequence:CCGGGTGAGGAGATTATCTGGGAAACTCGAGTTTCCCAGATAATCTCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-427s1c1
Sequence:CCGGGAGTGCTTGAAGATGGTCTTTCTCGAGAAAGACCATCTTCAAGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-52s1c1
Sequence:CCGGGCCCAACAGGAATTAGACAATCTCGAGATTGTCTAATTCCTGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-690s1c1
Sequence:CCGGGAAGCTCATCTCTGAGGAGTTCTCGAGAACTCCTCAGAGATGAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020015
MAGEA1 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 1 (directs expression of antigen MZ2-E)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-141s21c1
Sequence:CCGGGAAACCATGGAGACGTCAGAGCTCGAGCTCTGACGTCTCCATGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-1018s21c1
Sequence:CCGGCATTCTAGTGTATTGGCATTTCTCGAGAAATGCCAATACACTAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-945s21c1
Sequence:CCGGGCTTTGCGAGATGAGATATACCTCGAGGTATATCTCATCTCGCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020015.2-1181s21c1
Sequence:CCGGATCGTAGTATAAGGTCCAATACTCGAGTATTGGACCTTATACTACGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-534s21c1
Sequence:CCGGCCCTCTGTCCACTCCTATATCCTCGAGGATATAGGAGTGGACAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-262s1c1
Sequence:CCGGCCACTTTATTTGTTGCACAATCTCGAGATTGTGCAACAAATAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-611s1c1
Sequence:CCGGGTGAGGAGATTATCTGGGAAACTCGAGTTTCCCAGATAATCTCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-427s1c1
Sequence:CCGGGAGTGCTTGAAGATGGTCTTTCTCGAGAAAGACCATCTTCAAGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-52s1c1
Sequence:CCGGGCCCAACAGGAATTAGACAATCTCGAGATTGTCTAATTCCTGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-690s1c1
Sequence:CCGGGAAGCTCATCTCTGAGGAGTTCTCGAGAACTCCTCAGAGATGAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020015
MAGEA1 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 1 (directs expression of antigen MZ2-E)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-141s21c1
Sequence:CCGGGAAACCATGGAGACGTCAGAGCTCGAGCTCTGACGTCTCCATGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-1018s21c1
Sequence:CCGGCATTCTAGTGTATTGGCATTTCTCGAGAAATGCCAATACACTAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-945s21c1
Sequence:CCGGGCTTTGCGAGATGAGATATACCTCGAGGTATATCTCATCTCGCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020015.2-1181s21c1
Sequence:CCGGATCGTAGTATAAGGTCCAATACTCGAGTATTGGACCTTATACTACGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020015.2-534s21c1
Sequence:CCGGCCCTCTGTCCACTCCTATATCCTCGAGGATATAGGAGTGGACAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-262s1c1
Sequence:CCGGCCACTTTATTTGTTGCACAATCTCGAGATTGTGCAACAAATAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-611s1c1
Sequence:CCGGGTGAGGAGATTATCTGGGAAACTCGAGTTTCCCAGATAATCTCCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-427s1c1
Sequence:CCGGGAGTGCTTGAAGATGGTCTTTCTCGAGAAAGACCATCTTCAAGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-52s1c1
Sequence:CCGGGCCCAACAGGAATTAGACAATCTCGAGATTGTCTAATTCCTGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020015.1-690s1c1
Sequence:CCGGGAAGCTCATCTCTGAGGAGTTCTCGAGAACTCCTCAGAGATGAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004988
MAGEA1 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 1 (directs expression of antigen MZ2-E)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000159029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004988.3-1431s1c1
Sequence:CCGGGATTGGGAAATCCATTCTATTCTCGAGAATAGAATGGATTTCCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-733s1c1
Sequence:CCGGGCTGGGTGATAATCAGATCATCTCGAGATGATCTGATTATCACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-1028s1c1
Sequence:CCGGGAGTATGTGATCAAGGTCAGTCTCGAGACTGACCTTGATCACATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-481s1c1
Sequence:CCGGCCGAGCAGTAATCACTAAGAACTCGAGTTCTTAGTGATTACTGCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-769s1c1
Sequence:CCGGCCTGATAATTGTCCTGGTCATCTCGAGATGACCAGGACAATTATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004988.3-1375s1c1
Sequence:CCGGGCAGTCACACAGTTCTGTGTACTCGAGTACACAGAACTGTGTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-550s1c1
Sequence:CCGGGCCAGTCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-906s1c1
Sequence:CCGGCCCAAGATTTGGTGCAGGAAACTCGAGTTTCCTGCACCAAATCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-839s1c1
Sequence:CCGGCTGAGTGTGATGGAGGTGTATCTCGAGATACACCTCCATCACACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-457s1c1
Sequence:CCGGCTCTTGTATCCTGGAGTCCTTCTCGAGAAGGACTCCAGGATACAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-1012s1c1
Sequence:CCGGCTATGTGAAAGTCCTTGAGTACTCGAGTACTCAAGGACTTTCACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004988
MAGEA1 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 1 (directs expression of antigen MZ2-E)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000159029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004988.3-1431s1c1
Sequence:CCGGGATTGGGAAATCCATTCTATTCTCGAGAATAGAATGGATTTCCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-733s1c1
Sequence:CCGGGCTGGGTGATAATCAGATCATCTCGAGATGATCTGATTATCACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-1028s1c1
Sequence:CCGGGAGTATGTGATCAAGGTCAGTCTCGAGACTGACCTTGATCACATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-481s1c1
Sequence:CCGGCCGAGCAGTAATCACTAAGAACTCGAGTTCTTAGTGATTACTGCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-769s1c1
Sequence:CCGGCCTGATAATTGTCCTGGTCATCTCGAGATGACCAGGACAATTATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004988.3-1375s1c1
Sequence:CCGGGCAGTCACACAGTTCTGTGTACTCGAGTACACAGAACTGTGTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-550s1c1
Sequence:CCGGGCCAGTCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-906s1c1
Sequence:CCGGCCCAAGATTTGGTGCAGGAAACTCGAGTTTCCTGCACCAAATCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-839s1c1
Sequence:CCGGCTGAGTGTGATGGAGGTGTATCTCGAGATACACCTCCATCACACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-457s1c1
Sequence:CCGGCTCTTGTATCCTGGAGTCCTTCTCGAGAAGGACTCCAGGATACAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-1012s1c1
Sequence:CCGGCTATGTGAAAGTCCTTGAGTACTCGAGTACTCAAGGACTTTCACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004988
MAGEA1 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 1 (directs expression of antigen MZ2-E)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000159029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004988.3-1431s1c1
Sequence:CCGGGATTGGGAAATCCATTCTATTCTCGAGAATAGAATGGATTTCCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-733s1c1
Sequence:CCGGGCTGGGTGATAATCAGATCATCTCGAGATGATCTGATTATCACCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-1028s1c1
Sequence:CCGGGAGTATGTGATCAAGGTCAGTCTCGAGACTGACCTTGATCACATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-481s1c1
Sequence:CCGGCCGAGCAGTAATCACTAAGAACTCGAGTTCTTAGTGATTACTGCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-769s1c1
Sequence:CCGGCCTGATAATTGTCCTGGTCATCTCGAGATGACCAGGACAATTATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004988.3-1375s1c1
Sequence:CCGGGCAGTCACACAGTTCTGTGTACTCGAGTACACAGAACTGTGTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-550s1c1
Sequence:CCGGGCCAGTCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-906s1c1
Sequence:CCGGCCCAAGATTTGGTGCAGGAAACTCGAGTTTCCTGCACCAAATCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-839s1c1
Sequence:CCGGCTGAGTGTGATGGAGGTGTATCTCGAGATACACCTCCATCACACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-457s1c1
Sequence:CCGGCTCTTGTATCCTGGAGTCCTTCTCGAGAAGGACTCCAGGATACAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004988.3-1012s1c1
Sequence:CCGGCTATGTGAAAGTCCTTGAGTACTCGAGTACTCAAGGACTTTCACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)