EMAIL THIS PAGE TO A FRIEND

MAGEA2

melanoma antigen family A, 2

36 Gene Product Result for
Synonyms: CT1.2 MAGE2 MAGEA2A
UniProtKB ID: P43356, A8K328, Q32NC6
Gene ID:
Human(4101) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. This gene has two identical copies at different loci. Alternatively spliced transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(17138) melanoma antigen, family A, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005361 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005361 Rosetta Predictions human pricing
NM_175742 Rosetta Predictions human pricing
NM_175743 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190697 predicted 1382
2 SASI_Hs01_00190699 predicted 1148
3 SASI_Hs01_00190700 predicted 1639
4 SASI_Hs01_00190701 predicted 798
5 SASI_Hs01_00190702 predicted 1338
6 SASI_Hs01_00190698 predicted 913
7 SASI_Hs01_00190703 predicted 817
8 SASI_Hs01_00190704 predicted 813
9 SASI_Hs01_00190705 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216364 predicted 1374
2 SASI_Hs01_00216366 predicted 1133
3 SASI_Hs01_00216367 predicted 1624
4 SASI_Hs01_00216368 predicted 782
5 SASI_Hs01_00216369 predicted 1326
6 SASI_Hs01_00216365 predicted 895
7 SASI_Hs01_00216370 predicted 806
8 SASI_Hs01_00216371 predicted 799
9 SASI_Hs01_00216372 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067515 predicted 1386
2 SASI_Hs01_00067517 predicted 1152
3 SASI_Hs01_00067518 predicted 1638
4 SASI_Hs01_00067519 predicted 795
5 SASI_Hs01_00067520 predicted 1342
6 SASI_Hs01_00067516 predicted 919
7 SASI_Hs01_00067521 predicted 813
8 SASI_Hs01_00067522 predicted 815
9 SASI_Hs01_00067523 predicted 817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005361
MAGEA2 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005361.2-1085s21c1
Sequence:CCGGGATAATCGTCCTGGCCATAATCTCGAGATTATGGCCAGGACGATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005361.2-1153s21c1
Sequence:CCGGTGAGTATGTTGGAGGTGTTTGCTCGAGCAAACACCTCCAACATACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005361.2-1357s21c1
Sequence:CCGGTCGGTGGAGAACCTCACATTTCTCGAGAAATGTGAGGTTCTCCACCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-896s1c1
Sequence:CCGGCCTCAGAAATTGCCAGGACTTCTCGAGAAGTCCTGGCAATTTCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-1313s1c1
Sequence:CCGGCATTGAAACCAGCTATGTGAACTCGAGTTCACATAGCTGGTTTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-801s1c1
Sequence:CCGGGCAATCAGTAGGAAGATGGTTCTCGAGAACCATCTTCCTACTGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-815s1c1
Sequence:CCGGGATGGTTGAGTTGGTTCATTTCTCGAGAAATGAACCAACTCAACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005361
MAGEA2 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005361.2-1085s21c1
Sequence:CCGGGATAATCGTCCTGGCCATAATCTCGAGATTATGGCCAGGACGATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005361.2-1153s21c1
Sequence:CCGGTGAGTATGTTGGAGGTGTTTGCTCGAGCAAACACCTCCAACATACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005361.2-1357s21c1
Sequence:CCGGTCGGTGGAGAACCTCACATTTCTCGAGAAATGTGAGGTTCTCCACCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-896s1c1
Sequence:CCGGCCTCAGAAATTGCCAGGACTTCTCGAGAAGTCCTGGCAATTTCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-1313s1c1
Sequence:CCGGCATTGAAACCAGCTATGTGAACTCGAGTTCACATAGCTGGTTTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-801s1c1
Sequence:CCGGGCAATCAGTAGGAAGATGGTTCTCGAGAACCATCTTCCTACTGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-815s1c1
Sequence:CCGGGATGGTTGAGTTGGTTCATTTCTCGAGAAATGAACCAACTCAACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005361
MAGEA2 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005361.2-1085s21c1
Sequence:CCGGGATAATCGTCCTGGCCATAATCTCGAGATTATGGCCAGGACGATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005361.2-1153s21c1
Sequence:CCGGTGAGTATGTTGGAGGTGTTTGCTCGAGCAAACACCTCCAACATACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005361.2-1357s21c1
Sequence:CCGGTCGGTGGAGAACCTCACATTTCTCGAGAAATGTGAGGTTCTCCACCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-896s1c1
Sequence:CCGGCCTCAGAAATTGCCAGGACTTCTCGAGAAGTCCTGGCAATTTCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-1313s1c1
Sequence:CCGGCATTGAAACCAGCTATGTGAACTCGAGTTCACATAGCTGGTTTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-801s1c1
Sequence:CCGGGCAATCAGTAGGAAGATGGTTCTCGAGAACCATCTTCCTACTGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005361.2-815s1c1
Sequence:CCGGGATGGTTGAGTTGGTTCATTTCTCGAGAAATGAACCAACTCAACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020016
MAGEA2 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020016.1-1535s1c1
Sequence:CCGGGTTTCAAGATACTAGCGACATCTCGAGATGTCGCTAGTATCTTGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-848s1c1
Sequence:CCGGGCCCAAGACAGGTATCCTCATCTCGAGATGAGGATACCTGTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-407s1c1
Sequence:CCGGAGATACCACCACCTCAAATAACTCGAGTTATTTGAGGTGGTGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-1131s1c1
Sequence:CCGGGCCAGCATTAATAAGACTCATCTCGAGATGAGTCTTATTAATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-575s1c1
Sequence:CCGGGCACAATGCACAGAACACAAACTCGAGTTTGTGTTCTGTGCATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020016
MAGEA2 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020016.1-1535s1c1
Sequence:CCGGGTTTCAAGATACTAGCGACATCTCGAGATGTCGCTAGTATCTTGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-848s1c1
Sequence:CCGGGCCCAAGACAGGTATCCTCATCTCGAGATGAGGATACCTGTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-407s1c1
Sequence:CCGGAGATACCACCACCTCAAATAACTCGAGTTATTTGAGGTGGTGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-1131s1c1
Sequence:CCGGGCCAGCATTAATAAGACTCATCTCGAGATGAGTCTTATTAATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-575s1c1
Sequence:CCGGGCACAATGCACAGAACACAAACTCGAGTTTGTGTTCTGTGCATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020016
MAGEA2 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020016.1-1535s1c1
Sequence:CCGGGTTTCAAGATACTAGCGACATCTCGAGATGTCGCTAGTATCTTGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-848s1c1
Sequence:CCGGGCCCAAGACAGGTATCCTCATCTCGAGATGAGGATACCTGTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-407s1c1
Sequence:CCGGAGATACCACCACCTCAAATAACTCGAGTTATTTGAGGTGGTGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-1131s1c1
Sequence:CCGGGCCAGCATTAATAAGACTCATCTCGAGATGAGTCTTATTAATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020016.1-575s1c1
Sequence:CCGGGCACAATGCACAGAACACAAACTCGAGTTTGTGTTCTGTGCATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)