EMAIL THIS PAGE TO A FRIEND

MAGEA2B

melanoma antigen family A, 2B

13 Gene Product Result for
Synonyms: MAGE2 MAGEA2
Species: Human MAGEA2B(266740)
Gene ID:
Human(266740) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. This gene has two identical copies at different loci. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103942 Anti-MAGEA2B (233-245) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153488 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153001 MISSION® esiRNA esiRNA human MAGEA2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153488 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229418 predicted 1038
2 SASI_Hs01_00229420 predicted 801
3 SASI_Hs01_00229421 predicted 1290
4 SASI_Hs01_00229422 predicted 454
5 SASI_Hs01_00229423 predicted 1000
6 SASI_Hs01_00229419 predicted 568
7 SASI_Hs01_00229424 predicted 473
8 SASI_Hs01_00229425 predicted 456
9 SASI_Hs01_00229426 predicted 460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153488
MAGEA2B MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 2B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-447s1c1
Sequence:CCGGCCAAGCAGCAATCAGTAGGAACTCGAGTTCCTACTGATTGCTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153488.3-1220s1c1
Sequence:CCGGGCAGTGAGTTTCTGTTCTGTTCTCGAGAACAGAACAGAAACTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-963s1c1
Sequence:CCGGCCTCATTGAAACCAGCTATGTCTCGAGACATAGCTGGTTTCAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153488.3-1400s1c1
Sequence:CCGGGATTGGGAAATCCATTCCATTCTCGAGAATGGAATGGATTTCCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-454s1c1
Sequence:CCGGGCAATCAGTAGGAAGATGGTTCTCGAGAACCATCTTCCTACTGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-538s1c1
Sequence:CCGGCTGGAGAGTGTCCTCAGAAATCTCGAGATTTCTGAGGACACTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153488
MAGEA2B MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 2B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-447s1c1
Sequence:CCGGCCAAGCAGCAATCAGTAGGAACTCGAGTTCCTACTGATTGCTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153488.3-1220s1c1
Sequence:CCGGGCAGTGAGTTTCTGTTCTGTTCTCGAGAACAGAACAGAAACTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-963s1c1
Sequence:CCGGCCTCATTGAAACCAGCTATGTCTCGAGACATAGCTGGTTTCAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153488.3-1400s1c1
Sequence:CCGGGATTGGGAAATCCATTCCATTCTCGAGAATGGAATGGATTTCCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-454s1c1
Sequence:CCGGGCAATCAGTAGGAAGATGGTTCTCGAGAACCATCTTCCTACTGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-538s1c1
Sequence:CCGGCTGGAGAGTGTCCTCAGAAATCTCGAGATTTCTGAGGACACTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153488
MAGEA2B MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 2B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-447s1c1
Sequence:CCGGCCAAGCAGCAATCAGTAGGAACTCGAGTTCCTACTGATTGCTGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153488.3-1220s1c1
Sequence:CCGGGCAGTGAGTTTCTGTTCTGTTCTCGAGAACAGAACAGAAACTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-963s1c1
Sequence:CCGGCCTCATTGAAACCAGCTATGTCTCGAGACATAGCTGGTTTCAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153488.3-1400s1c1
Sequence:CCGGGATTGGGAAATCCATTCCATTCTCGAGAATGGAATGGATTTCCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-454s1c1
Sequence:CCGGGCAATCAGTAGGAAGATGGTTCTCGAGAACCATCTTCCTACTGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153488.3-538s1c1
Sequence:CCGGCTGGAGAGTGTCCTCAGAAATCTCGAGATTTCTGAGGACACTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)