EMAIL THIS PAGE TO A FRIEND

MAGEA3

melanoma antigen family A, 3

27 Gene Product Result for
Synonyms: CT1.3 HIP8 HYPD MAGE3 MAGEA6
UniProtKB ID: P43357, Q6FHI6
Gene ID:
Human(4102) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. [provided by RefSeq, Jul 2008]
Mouse(17139) melanoma antigen, family A, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091721 MISSION® esiRNA esiRNA targeting mouse Magea3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005362 Rosetta Predictions human pricing
NM_020017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052558 predicted 1066
2 SASI_Hs01_00052559 predicted 948
3 SASI_Hs01_00052560 predicted 1312
4 SASI_Hs01_00052561 predicted 533
5 SASI_Hs01_00052562 predicted 635
6 SASI_Hs01_00052563 predicted 447
7 SASI_Hs01_00052564 predicted 724
8 SASI_Hs01_00052565 predicted 947
9 SASI_Hs01_00052566 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170803 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005362
MAGEA3 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005362.3-1401s1c1
Sequence:CCGGCCAGGTTTATGAATGACAGTACTCGAGTACTGTCATTCATAAACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005362.3-629s1c1
Sequence:CCGGCGGAAATTGGCAGTATTTCTTCTCGAGAAGAAATACTGCCAATTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005362.3-638s1c1
Sequence:CCGGGCAGTATTTCTTTCCTGTGATCTCGAGATCACAGGAAAGAAATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005362.3-1411s1c1
Sequence:CCGGGAATGACAGTAGTCACACATACTCGAGTATGTGTGACTACTGTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005362.3-813s1c1
Sequence:CCGGCTGATAATCGTCCTGGCCATACTCGAGTATGGCCAGGACGATTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005362
MAGEA3 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005362.3-1401s1c1
Sequence:CCGGCCAGGTTTATGAATGACAGTACTCGAGTACTGTCATTCATAAACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005362.3-629s1c1
Sequence:CCGGCGGAAATTGGCAGTATTTCTTCTCGAGAAGAAATACTGCCAATTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005362.3-638s1c1
Sequence:CCGGGCAGTATTTCTTTCCTGTGATCTCGAGATCACAGGAAAGAAATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005362.3-1411s1c1
Sequence:CCGGGAATGACAGTAGTCACACATACTCGAGTATGTGTGACTACTGTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005362.3-813s1c1
Sequence:CCGGCTGATAATCGTCCTGGCCATACTCGAGTATGGCCAGGACGATTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005362
MAGEA3 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005362.3-1401s1c1
Sequence:CCGGCCAGGTTTATGAATGACAGTACTCGAGTACTGTCATTCATAAACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005362.3-629s1c1
Sequence:CCGGCGGAAATTGGCAGTATTTCTTCTCGAGAAGAAATACTGCCAATTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005362.3-638s1c1
Sequence:CCGGGCAGTATTTCTTTCCTGTGATCTCGAGATCACAGGAAAGAAATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005362.3-1411s1c1
Sequence:CCGGGAATGACAGTAGTCACACATACTCGAGTATGTGTGACTACTGTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005362.3-813s1c1
Sequence:CCGGCTGATAATCGTCCTGGCCATACTCGAGTATGGCCAGGACGATTATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020017
VALIDATED
MAGEA3 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020017.1-261s1c1
Sequence:CCGGCCCACTTCATTTGTTGCACAACTCGAGTTGTGCAACAAATGAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020017.1-283s1c1
Sequence:CCGGGCACAGAACACAAAGGTGTATCTCGAGATACACCTTTGTGTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020017.1-115s1c1
Sequence:CCGGACCACCTCAAATAAAGTGTATCTCGAGATACACTTTATTTGAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020017.1-353s1c1
Sequence:CCGGCCAAAGCAGAAATGTTGGAAACTCGAGTTTCCAACATTTCTGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020017.1-528s1c1
Sequence:CCGGGATGACTGATGTCCAGGGTATCTCGAGATACCCTGGACATCAGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-53s21c1
Sequence:CCGGCCCAACAGGAATTAGACAATGCTCGAGCATTGTCTAATTCCTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-396s21c1
Sequence:CCGGGTACTACCCTCTGATCTTTAGCTCGAGCTAAAGATCAGAGGGTAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-472s21c1
Sequence:CCGGTCCTCTGTCCACACCTATATGCTCGAGCATATAGGTGTGGACAGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020017.1-662s21c1
Sequence:CCGGGGGATCCTTACATACATAAAGCTCGAGCTTTATGTATGTAAGGATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020017.1-732s21c1
Sequence:CCGGATACAGGCAGGTGCCCAATAGCTCGAGCTATTGGGCACCTGCCTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-221s21c1
Sequence:CCGGCTGAGGAAGCTTCCATCAAAGCTCGAGCTTTGATGGAAGCTTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020017.1-109s21c1
Sequence:CCGGGATACCACCACCTCAAATAAACTCGAGTTTATTTGAGGTGGTGGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020017
VALIDATED
MAGEA3 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020017.1-261s1c1
Sequence:CCGGCCCACTTCATTTGTTGCACAACTCGAGTTGTGCAACAAATGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020017.1-283s1c1
Sequence:CCGGGCACAGAACACAAAGGTGTATCTCGAGATACACCTTTGTGTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020017.1-115s1c1
Sequence:CCGGACCACCTCAAATAAAGTGTATCTCGAGATACACTTTATTTGAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020017.1-353s1c1
Sequence:CCGGCCAAAGCAGAAATGTTGGAAACTCGAGTTTCCAACATTTCTGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020017.1-528s1c1
Sequence:CCGGGATGACTGATGTCCAGGGTATCTCGAGATACCCTGGACATCAGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-53s21c1
Sequence:CCGGCCCAACAGGAATTAGACAATGCTCGAGCATTGTCTAATTCCTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-396s21c1
Sequence:CCGGGTACTACCCTCTGATCTTTAGCTCGAGCTAAAGATCAGAGGGTAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-472s21c1
Sequence:CCGGTCCTCTGTCCACACCTATATGCTCGAGCATATAGGTGTGGACAGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020017.1-662s21c1
Sequence:CCGGGGGATCCTTACATACATAAAGCTCGAGCTTTATGTATGTAAGGATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020017.1-732s21c1
Sequence:CCGGATACAGGCAGGTGCCCAATAGCTCGAGCTATTGGGCACCTGCCTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-221s21c1
Sequence:CCGGCTGAGGAAGCTTCCATCAAAGCTCGAGCTTTGATGGAAGCTTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020017.1-109s21c1
Sequence:CCGGGATACCACCACCTCAAATAAACTCGAGTTTATTTGAGGTGGTGGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020017
VALIDATED
MAGEA3 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020017.1-261s1c1
Sequence:CCGGCCCACTTCATTTGTTGCACAACTCGAGTTGTGCAACAAATGAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020017.1-283s1c1
Sequence:CCGGGCACAGAACACAAAGGTGTATCTCGAGATACACCTTTGTGTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020017.1-115s1c1
Sequence:CCGGACCACCTCAAATAAAGTGTATCTCGAGATACACTTTATTTGAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020017.1-353s1c1
Sequence:CCGGCCAAAGCAGAAATGTTGGAAACTCGAGTTTCCAACATTTCTGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020017.1-528s1c1
Sequence:CCGGGATGACTGATGTCCAGGGTATCTCGAGATACCCTGGACATCAGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-53s21c1
Sequence:CCGGCCCAACAGGAATTAGACAATGCTCGAGCATTGTCTAATTCCTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-396s21c1
Sequence:CCGGGTACTACCCTCTGATCTTTAGCTCGAGCTAAAGATCAGAGGGTAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-472s21c1
Sequence:CCGGTCCTCTGTCCACACCTATATGCTCGAGCATATAGGTGTGGACAGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020017.1-662s21c1
Sequence:CCGGGGGATCCTTACATACATAAAGCTCGAGCTTTATGTATGTAAGGATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020017.1-732s21c1
Sequence:CCGGATACAGGCAGGTGCCCAATAGCTCGAGCTATTGGGCACCTGCCTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020017.1-221s21c1
Sequence:CCGGCTGAGGAAGCTTCCATCAAAGCTCGAGCTTTGATGGAAGCTTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020017.1-109s21c1
Sequence:CCGGGATACCACCACCTCAAATAAACTCGAGTTTATTTGAGGTGGTGGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)