EMAIL THIS PAGE TO A FRIEND

MAGEA4

melanoma antigen family A, 4

78 Gene Product Result for
Synonyms: CT1.4 MAGE-41 MAGE-X2 MAGE4 MAGE4A MAGE4B
UniProtKB ID: P43358, Q14798
Gene ID:
Human(4103) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. At least four variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17140) melanoma antigen, family A, 4
Rat(689858) melanoma antigen, family A, 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020280 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020280 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020280 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002362 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU092451 MISSION® esiRNA esiRNA targeting mouse Magea4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011548 Rosetta Predictions human pricing
NM_001011549 Rosetta Predictions human pricing
NM_001011550 Rosetta Predictions human pricing
NM_002362 Rosetta Predictions human pricing
NM_001109550 Rosetta Predictions rat pricing
NM_020280 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135399 predicted 543
2 SASI_Hs01_00135400 predicted 1302
3 SASI_Hs01_00135401 predicted 781
4 SASI_Hs01_00135402 predicted 1131
5 SASI_Hs01_00135403 predicted 839
6 SASI_Hs01_00135404 predicted 443
7 SASI_Hs01_00135405 predicted 688
8 SASI_Hs01_00135406 predicted 1265
9 SASI_Hs01_00135407 predicted 1345
10 SASI_Hs01_00135408 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101515 predicted 543
2 SASI_Hs01_00101516 predicted 1299
3 SASI_Hs01_00101517 predicted 787
4 SASI_Hs01_00101518 predicted 1135
5 SASI_Hs01_00101519 predicted 837
6 SASI_Hs01_00101520 predicted 440
7 SASI_Hs01_00101521 predicted 683
8 SASI_Hs01_00101522 predicted 1269
9 SASI_Hs01_00101523 predicted 1338
10 SASI_Hs01_00101524 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094654 predicted 534
2 SASI_Hs01_00094655 predicted 1285
3 SASI_Hs01_00094656 predicted 771
4 SASI_Hs01_00094657 predicted 1123
5 SASI_Hs01_00094658 predicted 831
6 SASI_Hs01_00094659 predicted 432
7 SASI_Hs01_00094660 predicted 673
8 SASI_Hs01_00094661 predicted 1258
9 SASI_Hs01_00094662 predicted 1333
10 SASI_Hs01_00094663 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195846 predicted 551
2 SASI_Hs01_00195847 predicted 1305
3 SASI_Hs01_00195848 predicted 788
4 SASI_Hs01_00195849 predicted 1143
5 SASI_Hs01_00195850 predicted 843
6 SASI_Hs01_00195851 predicted 446
7 SASI_Hs01_00195852 predicted 691
8 SASI_Hs01_00195853 predicted 1275
9 SASI_Hs01_00195854 predicted 1345
10 SASI_Hs01_00195855 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249499 predicted 275
2 SASI_Rn02_00249500 predicted 543
3 SASI_Rn02_00249501 predicted 443
4 SASI_Rn02_00249502 predicted 447
5 SASI_Rn02_00249503 predicted 277
6 SASI_Rn02_00249504 predicted 212
7 SASI_Rn02_00249505 predicted 246
8 SASI_Rn02_00249506 predicted 601
9 SASI_Rn02_00249507 predicted 376
10 SASI_Rn02_00249508 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127813 predicted 198
2 SASI_Mm01_00127815 predicted 455
3 SASI_Mm01_00127816 predicted 555
4 SASI_Mm01_00127817 predicted 279
5 SASI_Mm01_00127818 predicted 263
6 SASI_Mm01_00127819 predicted 466
7 SASI_Mm01_00127820 predicted 468
8 SASI_Mm01_00127821 predicted 567
9 SASI_Mm02_00325482 predicted 659
10 SASI_Mm02_00325483 predicted 269
11 SASI_Mm01_00127812 predicted 238
12 SASI_Mm01_00127814 predicted 293
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020280
MAGEA4 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.2-471s21c1
Sequence:CCGGCCCATTTGTCCAATCCTATATCTCGAGATATAGGATTGGACAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.2-755s21c1
Sequence:CCGGATCCTCCAAGCTATGAGTTTCCTCGAGGAAACTCATAGCTTGGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-53s21c1
Sequence:CCGGGCCAAAGGGAGTTAGACAATGCTCGAGCATTGTCTAACTCCCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-472s21c1
Sequence:CCGGCCATTTGTCCAATCCTATATCCTCGAGGATATAGGATTGGACAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-297s21c1
Sequence:CCGGGTTATATGAATTGGCAACCTTCTCGAGAAGGTTGCCAATTCATATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-755s21c1
Sequence:CCGGATCCTCCGAGCTATGAGTTTCCTCGAGGAAACTCATAGCTCGGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-297s1c1
Sequence:CCGGGTTATATGAATTGGCAACCTTCTCGAGAAGGTTGCCAATTCATATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-76s1c1
Sequence:CCGGCAGGCTACAATAGCTGTGGTACTCGAGTACCACAGCTATTGTAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-119s1c1
Sequence:CCGGCCTCAAAGAAGGTGTACAGTACTCGAGTACTGTACACCTTCTTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-663s1c1
Sequence:CCGGGCATCTTTACATACATCAAGACTCGAGTCTTGATGTATGTAAAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-187s1c1
Sequence:CCGGCTTGTGATACTAGCCTCTGTTCTCGAGAACAGAGGCTAGTATCACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020280
MAGEA4 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.2-471s21c1
Sequence:CCGGCCCATTTGTCCAATCCTATATCTCGAGATATAGGATTGGACAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.2-755s21c1
Sequence:CCGGATCCTCCAAGCTATGAGTTTCCTCGAGGAAACTCATAGCTTGGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-53s21c1
Sequence:CCGGGCCAAAGGGAGTTAGACAATGCTCGAGCATTGTCTAACTCCCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-472s21c1
Sequence:CCGGCCATTTGTCCAATCCTATATCCTCGAGGATATAGGATTGGACAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-297s21c1
Sequence:CCGGGTTATATGAATTGGCAACCTTCTCGAGAAGGTTGCCAATTCATATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-755s21c1
Sequence:CCGGATCCTCCGAGCTATGAGTTTCCTCGAGGAAACTCATAGCTCGGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-297s1c1
Sequence:CCGGGTTATATGAATTGGCAACCTTCTCGAGAAGGTTGCCAATTCATATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-76s1c1
Sequence:CCGGCAGGCTACAATAGCTGTGGTACTCGAGTACCACAGCTATTGTAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-119s1c1
Sequence:CCGGCCTCAAAGAAGGTGTACAGTACTCGAGTACTGTACACCTTCTTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-663s1c1
Sequence:CCGGGCATCTTTACATACATCAAGACTCGAGTCTTGATGTATGTAAAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-187s1c1
Sequence:CCGGCTTGTGATACTAGCCTCTGTTCTCGAGAACAGAGGCTAGTATCACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020280
MAGEA4 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.2-471s21c1
Sequence:CCGGCCCATTTGTCCAATCCTATATCTCGAGATATAGGATTGGACAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.2-755s21c1
Sequence:CCGGATCCTCCAAGCTATGAGTTTCCTCGAGGAAACTCATAGCTTGGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-53s21c1
Sequence:CCGGGCCAAAGGGAGTTAGACAATGCTCGAGCATTGTCTAACTCCCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-472s21c1
Sequence:CCGGCCATTTGTCCAATCCTATATCCTCGAGGATATAGGATTGGACAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-297s21c1
Sequence:CCGGGTTATATGAATTGGCAACCTTCTCGAGAAGGTTGCCAATTCATATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020280.1-755s21c1
Sequence:CCGGATCCTCCGAGCTATGAGTTTCCTCGAGGAAACTCATAGCTCGGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-297s1c1
Sequence:CCGGGTTATATGAATTGGCAACCTTCTCGAGAAGGTTGCCAATTCATATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-76s1c1
Sequence:CCGGCAGGCTACAATAGCTGTGGTACTCGAGTACCACAGCTATTGTAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-119s1c1
Sequence:CCGGCCTCAAAGAAGGTGTACAGTACTCGAGTACTGTACACCTTCTTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-663s1c1
Sequence:CCGGGCATCTTTACATACATCAAGACTCGAGTCTTGATGTATGTAAAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020280.1-187s1c1
Sequence:CCGGCTTGTGATACTAGCCTCTGTTCTCGAGAACAGAGGCTAGTATCACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002362
MAGEA4 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-838s1c1
Sequence:CCGGCCTGGGCACAATTGCAATGGACTCGAGTCCATTGCAATTGTGCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-1142s1c1
Sequence:CCGGGCAGCTTTGTTAGAGGAGGAACTCGAGTTCCTCCTCTAACAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-607s1c1
Sequence:CCGGGCTGGTCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-1058s1c1
Sequence:CCGGGCTGAAACCAGCTATGTGAAACTCGAGTTTCACATAGCTGGTTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-694s1c1
Sequence:CCGGCCTGAAGATGATCTTTGGCATCTCGAGATGCCAAAGATCATCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-550s1c1
Sequence:CCGGCAGTAACAAGGTGGATGAGTTCTCGAGAACTCATCCACCTTGTTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-1100s1c1
Sequence:CCGGGTCAATGCAAGAGTTCGCATTCTCGAGAATGCGAACTCTTGCATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-688s1c1
Sequence:CCGGCGAGTCCCTGAAGATGATCTTCTCGAGAAGATCATCTTCAGGGACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-615s1c1
Sequence:CCGGCAAAGGCAGAAATGCTGGAGACTCGAGTCTCCAGCATTTCTGCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-1133s1c1
Sequence:CCGGCTGCGTGAAGCAGCTTTGTTACTCGAGTAACAAAGCTGCTTCACGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002362
MAGEA4 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-838s1c1
Sequence:CCGGCCTGGGCACAATTGCAATGGACTCGAGTCCATTGCAATTGTGCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-1142s1c1
Sequence:CCGGGCAGCTTTGTTAGAGGAGGAACTCGAGTTCCTCCTCTAACAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-607s1c1
Sequence:CCGGGCTGGTCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-1058s1c1
Sequence:CCGGGCTGAAACCAGCTATGTGAAACTCGAGTTTCACATAGCTGGTTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-694s1c1
Sequence:CCGGCCTGAAGATGATCTTTGGCATCTCGAGATGCCAAAGATCATCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-550s1c1
Sequence:CCGGCAGTAACAAGGTGGATGAGTTCTCGAGAACTCATCCACCTTGTTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-1100s1c1
Sequence:CCGGGTCAATGCAAGAGTTCGCATTCTCGAGAATGCGAACTCTTGCATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-688s1c1
Sequence:CCGGCGAGTCCCTGAAGATGATCTTCTCGAGAAGATCATCTTCAGGGACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-615s1c1
Sequence:CCGGCAAAGGCAGAAATGCTGGAGACTCGAGTCTCCAGCATTTCTGCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-1133s1c1
Sequence:CCGGCTGCGTGAAGCAGCTTTGTTACTCGAGTAACAAAGCTGCTTCACGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002362
MAGEA4 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-838s1c1
Sequence:CCGGCCTGGGCACAATTGCAATGGACTCGAGTCCATTGCAATTGTGCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-1142s1c1
Sequence:CCGGGCAGCTTTGTTAGAGGAGGAACTCGAGTTCCTCCTCTAACAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-607s1c1
Sequence:CCGGGCTGGTCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-1058s1c1
Sequence:CCGGGCTGAAACCAGCTATGTGAAACTCGAGTTTCACATAGCTGGTTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-694s1c1
Sequence:CCGGCCTGAAGATGATCTTTGGCATCTCGAGATGCCAAAGATCATCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002362.3-550s1c1
Sequence:CCGGCAGTAACAAGGTGGATGAGTTCTCGAGAACTCATCCACCTTGTTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-1100s1c1
Sequence:CCGGGTCAATGCAAGAGTTCGCATTCTCGAGAATGCGAACTCTTGCATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-688s1c1
Sequence:CCGGCGAGTCCCTGAAGATGATCTTCTCGAGAAGATCATCTTCAGGGACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-615s1c1
Sequence:CCGGCAAAGGCAGAAATGCTGGAGACTCGAGTCTCCAGCATTTCTGCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002362.3-1133s1c1
Sequence:CCGGCTGCGTGAAGCAGCTTTGTTACTCGAGTAACAAAGCTGCTTCACGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)