EMAIL THIS PAGE TO A FRIEND

MAGEA5

melanoma antigen family A, 5

76 Gene Product Result for
Synonyms: CT1.5 MAGE5 MAGEA4
UniProtKB ID: P43359, Q32MD0
Gene ID:
Human(4104) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. This MAGEA gene encodes a protein that is C-terminally truncated compared to other family members, and this gene can be alternatively interpreted to be a pseudogene. The protein is represented in this Gene record in accordance with the assumed protein-coding status defined in the literature. Read-through transcription exists between this gene and the upstream melanoma antigen family A, 10 (MAGEA10) gene. [provided by RefSeq, Oct 2011]
Mouse(17141) melanoma antigen, family A, 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021049 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020018 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020018 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020018 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132191 MISSION® esiRNA esiRNA human MAGEA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021049 Rosetta Predictions human pricing
NM_020018 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159283 predicted 998
2 SASI_Hs01_00159285 predicted 509
3 SASI_Hs01_00159286 predicted 839
4 SASI_Hs01_00159287 predicted 428
5 SASI_Hs01_00159288 predicted 502
6 SASI_Hs01_00159289 predicted 451
7 SASI_Hs01_00159290 predicted 433
8 SASI_Hs01_00159291 predicted 748
9 SASI_Hs01_00159292 predicted 992
10 SASI_Hs01_00159284 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133741 predicted 1201
2 SASI_Mm01_00133742 predicted 1217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021049
MAGEA5 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021049.3-431s1c1
Sequence:CCGGGATTTCACTCTATGGAGGCAACTCGAGTTGCCTCCATAGAGTGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021049.3-423s1c1
Sequence:CCGGCTGCCATCGATTTCACTCTATCTCGAGATAGAGTGAAATCGATGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021049.3-809s1c1
Sequence:CCGGCCTGATAATCGTCTTGGGCATCTCGAGATGCCCAAGACGATTATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021049.3-1222s1c1
Sequence:CCGGCCCTGCCTTAATGTGACATGACTCGAGTCATGTCACATTAAGGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021049.3-532s1c1
Sequence:CCGGCAGTAAGAAGGTGGCTGACTTCTCGAGAAGTCAGCCACCTTCTTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021049.3-1269s1c1
Sequence:CCGGGCAGTCAACATTCTTAGTAGTCTCGAGACTACTAAGAATGTTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021049.3-1274s1c1
Sequence:CCGGCAACATTCTTAGTAGTGGGTTCTCGAGAACCCACTACTAAGAATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021049.3-377s21c1
Sequence:CCGGTCACCAGGTCCTCTCAAGAGTCTCGAGACTCTTGAGAGGACCTGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021049.3-764s21c1
Sequence:CCGGTGGCCTGGTGGTTGATAATAACTCGAGTTATTATCAACCACCAGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021049.3-1037s21c1
Sequence:CCGGACTCGCTGCTTGAAAGTACTGCTCGAGCAGTACTTTCAAGCAGCGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021049.3-537s21c1
Sequence:CCGGAGAAGGTGGCTGACTTGATTCCTCGAGGAATCAAGTCAGCCACCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021049
MAGEA5 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021049.3-431s1c1
Sequence:CCGGGATTTCACTCTATGGAGGCAACTCGAGTTGCCTCCATAGAGTGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021049.3-423s1c1
Sequence:CCGGCTGCCATCGATTTCACTCTATCTCGAGATAGAGTGAAATCGATGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021049.3-809s1c1
Sequence:CCGGCCTGATAATCGTCTTGGGCATCTCGAGATGCCCAAGACGATTATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021049.3-1222s1c1
Sequence:CCGGCCCTGCCTTAATGTGACATGACTCGAGTCATGTCACATTAAGGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021049.3-532s1c1
Sequence:CCGGCAGTAAGAAGGTGGCTGACTTCTCGAGAAGTCAGCCACCTTCTTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021049.3-1269s1c1
Sequence:CCGGGCAGTCAACATTCTTAGTAGTCTCGAGACTACTAAGAATGTTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021049.3-1274s1c1
Sequence:CCGGCAACATTCTTAGTAGTGGGTTCTCGAGAACCCACTACTAAGAATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021049.3-377s21c1
Sequence:CCGGTCACCAGGTCCTCTCAAGAGTCTCGAGACTCTTGAGAGGACCTGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021049.3-764s21c1
Sequence:CCGGTGGCCTGGTGGTTGATAATAACTCGAGTTATTATCAACCACCAGGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021049.3-1037s21c1
Sequence:CCGGACTCGCTGCTTGAAAGTACTGCTCGAGCAGTACTTTCAAGCAGCGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021049.3-537s21c1
Sequence:CCGGAGAAGGTGGCTGACTTGATTCCTCGAGGAATCAAGTCAGCCACCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021049
MAGEA5 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021049.3-431s1c1
Sequence:CCGGGATTTCACTCTATGGAGGCAACTCGAGTTGCCTCCATAGAGTGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021049.3-423s1c1
Sequence:CCGGCTGCCATCGATTTCACTCTATCTCGAGATAGAGTGAAATCGATGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021049.3-809s1c1
Sequence:CCGGCCTGATAATCGTCTTGGGCATCTCGAGATGCCCAAGACGATTATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021049.3-1222s1c1
Sequence:CCGGCCCTGCCTTAATGTGACATGACTCGAGTCATGTCACATTAAGGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021049.3-532s1c1
Sequence:CCGGCAGTAAGAAGGTGGCTGACTTCTCGAGAAGTCAGCCACCTTCTTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021049.3-1269s1c1
Sequence:CCGGGCAGTCAACATTCTTAGTAGTCTCGAGACTACTAAGAATGTTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021049.3-1274s1c1
Sequence:CCGGCAACATTCTTAGTAGTGGGTTCTCGAGAACCCACTACTAAGAATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021049.3-377s21c1
Sequence:CCGGTCACCAGGTCCTCTCAAGAGTCTCGAGACTCTTGAGAGGACCTGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021049.3-764s21c1
Sequence:CCGGTGGCCTGGTGGTTGATAATAACTCGAGTTATTATCAACCACCAGGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021049.3-1037s21c1
Sequence:CCGGACTCGCTGCTTGAAAGTACTGCTCGAGCAGTACTTTCAAGCAGCGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021049.3-537s21c1
Sequence:CCGGAGAAGGTGGCTGACTTGATTCCTCGAGGAATCAAGTCAGCCACCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020018
VALIDATED
MAGEA5 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020018.1-839s1c1
Sequence:CCGGAGTGAGGAGATTATCTGGGAACTCGAGTTCCCAGATAATCTCCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020018.1-862s1c1
Sequence:CCGGGCTGAATAACATAGGGTTGTACTCGAGTACAACCCTATGTTATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020018.1-1206s1c1
Sequence:CCGGCCCTTCTAACTCCAGGTCATACTCGAGTATGACCTGGAGTTAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020018.1-573s1c1
Sequence:CCGGCATTCACTACCAAAGCAGAAACTCGAGTTTCTGCTTTGGTAGTGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020018.1-1109s1c1
Sequence:CCGGGAGGCTTTGCAAGATGAGATACTCGAGTATCTCATCTTGCAAAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020018
VALIDATED
MAGEA5 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020018.1-839s1c1
Sequence:CCGGAGTGAGGAGATTATCTGGGAACTCGAGTTCCCAGATAATCTCCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020018.1-862s1c1
Sequence:CCGGGCTGAATAACATAGGGTTGTACTCGAGTACAACCCTATGTTATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020018.1-1206s1c1
Sequence:CCGGCCCTTCTAACTCCAGGTCATACTCGAGTATGACCTGGAGTTAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020018.1-573s1c1
Sequence:CCGGCATTCACTACCAAAGCAGAAACTCGAGTTTCTGCTTTGGTAGTGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020018.1-1109s1c1
Sequence:CCGGGAGGCTTTGCAAGATGAGATACTCGAGTATCTCATCTTGCAAAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020018
VALIDATED
MAGEA5 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020018.1-839s1c1
Sequence:CCGGAGTGAGGAGATTATCTGGGAACTCGAGTTCCCAGATAATCTCCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020018.1-862s1c1
Sequence:CCGGGCTGAATAACATAGGGTTGTACTCGAGTACAACCCTATGTTATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020018.1-1206s1c1
Sequence:CCGGCCCTTCTAACTCCAGGTCATACTCGAGTATGACCTGGAGTTAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020018.1-573s1c1
Sequence:CCGGCATTCACTACCAAAGCAGAAACTCGAGTTTCTGCTTTGGTAGTGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020018.1-1109s1c1
Sequence:CCGGGAGGCTTTGCAAGATGAGATACTCGAGTATCTCATCTTGCAAAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)