EMAIL THIS PAGE TO A FRIEND

MAGEA6

melanoma antigen family A, 6

32 Gene Product Result for
Synonyms: CT1.6 MAGE-3b MAGE3B MAGE6
UniProtKB ID: P43360, A8IF93, Q6NW44
Gene ID:
Human(4105) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(17142) melanoma antigen, family A, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301724 Anti-MAGEA6 affinity isolated antibody human
immunohistochemistry pricing
SAB1300320 Anti-MAGEA6 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB2101420 Anti-MAGEA6 antibody produced in rabbit affinity isolated antibody rat, horse, canine, mouse, rabbit, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005363 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005363 Rosetta Predictions human pricing
NM_175868 Rosetta Predictions human pricing
NM_020019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102760 predicted 1046
2 SASI_Hs01_00102761 predicted 516
3 SASI_Hs01_00102762 predicted 1300
4 SASI_Hs01_00102763 predicted 433
5 SASI_Hs01_00102764 predicted 925
6 SASI_Hs01_00102765 predicted 925
7 SASI_Hs01_00102766 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164837 predicted 1113
2 SASI_Hs01_00164838 predicted 581
3 SASI_Hs01_00164839 predicted 1364
4 SASI_Hs01_00164840 predicted 502
5 SASI_Hs01_00164841 predicted 992
6 SASI_Hs01_00164842 predicted 989
7 SASI_Hs01_00164843 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086655 predicted 540
2 SASI_Mm01_00086656 predicted 544
3 SASI_Mm01_00086659 predicted 1156
4 SASI_Mm01_00086657 predicted 1136
5 SASI_Mm01_00086658 predicted 1100
6 SASI_Mm01_00086660 predicted 1129
7 SASI_Mm01_00086661 predicted 1082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020019
VALIDATED
MAGEA6 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 6
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-453s21c1
Sequence:CCGGTGTATGACTTGGTGGACTTTCCTCGAGGAAAGTCCACCAAGTCATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-780s21c1
Sequence:CCGGGGGAAATGCTGAATAACATAGCTCGAGCTATGTTATTCAGCATTTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-549s21c1
Sequence:CCGGAGTACTTCCCTGTGATCTTTACTCGAGTAAAGATCACAGGGAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020019.3-404s21c1
Sequence:CCGGGGCCTGGAAGACCCACTTTATCTCGAGATAAAGTGGGTCTTCCAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020019.3-626s21c1
Sequence:CCGGCCCTCTGTCCACTCCTATATGCTCGAGCATATAGGAGTGGACAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-903s21c1
Sequence:CCGGATAGTGATCCTCCTATCTATGCTCGAGCATAGATAGGAGGATCACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020019.3-705s21c1
Sequence:CCGGCCAAGACAGGTATCCTCATAGCTCGAGCTATGAGGATACCTGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-758s21c1
Sequence:CCGGTATGTCAGTGAGGAGGTTATCCTCGAGGATAACCTCCTCACTGACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020019.1-357s1c1
Sequence:CCGGAGCAGAAATGTTGGAAAGTATCTCGAGATACTTTCCAACATTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020019.1-358s1c1
Sequence:CCGGGCAGAAATGTTGGAAAGTATTCTCGAGAATACTTTCCAACATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020019.1-744s1c1
Sequence:CCGGGCCCAATAGTGATCCTCCTATCTCGAGATAGGAGGATCACTATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020019.1-251s1c1
Sequence:CCGGGCCTGGAAGACCCACTTTATTCTCGAGAATAAAGTGGGTCTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020019.1-52s1c1
Sequence:CCGGGCTCAACAGGAATCAGACAATCTCGAGATTGTCTGATTCCTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020019
VALIDATED
MAGEA6 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 6
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-453s21c1
Sequence:CCGGTGTATGACTTGGTGGACTTTCCTCGAGGAAAGTCCACCAAGTCATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-780s21c1
Sequence:CCGGGGGAAATGCTGAATAACATAGCTCGAGCTATGTTATTCAGCATTTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-549s21c1
Sequence:CCGGAGTACTTCCCTGTGATCTTTACTCGAGTAAAGATCACAGGGAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020019.3-404s21c1
Sequence:CCGGGGCCTGGAAGACCCACTTTATCTCGAGATAAAGTGGGTCTTCCAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020019.3-626s21c1
Sequence:CCGGCCCTCTGTCCACTCCTATATGCTCGAGCATATAGGAGTGGACAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-903s21c1
Sequence:CCGGATAGTGATCCTCCTATCTATGCTCGAGCATAGATAGGAGGATCACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020019.3-705s21c1
Sequence:CCGGCCAAGACAGGTATCCTCATAGCTCGAGCTATGAGGATACCTGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-758s21c1
Sequence:CCGGTATGTCAGTGAGGAGGTTATCCTCGAGGATAACCTCCTCACTGACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020019.1-357s1c1
Sequence:CCGGAGCAGAAATGTTGGAAAGTATCTCGAGATACTTTCCAACATTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020019.1-358s1c1
Sequence:CCGGGCAGAAATGTTGGAAAGTATTCTCGAGAATACTTTCCAACATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020019.1-744s1c1
Sequence:CCGGGCCCAATAGTGATCCTCCTATCTCGAGATAGGAGGATCACTATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020019.1-251s1c1
Sequence:CCGGGCCTGGAAGACCCACTTTATTCTCGAGAATAAAGTGGGTCTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020019.1-52s1c1
Sequence:CCGGGCTCAACAGGAATCAGACAATCTCGAGATTGTCTGATTCCTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020019
VALIDATED
MAGEA6 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 6
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-453s21c1
Sequence:CCGGTGTATGACTTGGTGGACTTTCCTCGAGGAAAGTCCACCAAGTCATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-780s21c1
Sequence:CCGGGGGAAATGCTGAATAACATAGCTCGAGCTATGTTATTCAGCATTTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-549s21c1
Sequence:CCGGAGTACTTCCCTGTGATCTTTACTCGAGTAAAGATCACAGGGAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020019.3-404s21c1
Sequence:CCGGGGCCTGGAAGACCCACTTTATCTCGAGATAAAGTGGGTCTTCCAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020019.3-626s21c1
Sequence:CCGGCCCTCTGTCCACTCCTATATGCTCGAGCATATAGGAGTGGACAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-903s21c1
Sequence:CCGGATAGTGATCCTCCTATCTATGCTCGAGCATAGATAGGAGGATCACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020019.3-705s21c1
Sequence:CCGGCCAAGACAGGTATCCTCATAGCTCGAGCTATGAGGATACCTGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020019.3-758s21c1
Sequence:CCGGTATGTCAGTGAGGAGGTTATCCTCGAGGATAACCTCCTCACTGACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020019.1-357s1c1
Sequence:CCGGAGCAGAAATGTTGGAAAGTATCTCGAGATACTTTCCAACATTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020019.1-358s1c1
Sequence:CCGGGCAGAAATGTTGGAAAGTATTCTCGAGAATACTTTCCAACATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020019.1-744s1c1
Sequence:CCGGGCCCAATAGTGATCCTCCTATCTCGAGATAGGAGGATCACTATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020019.1-251s1c1
Sequence:CCGGGCCTGGAAGACCCACTTTATTCTCGAGAATAAAGTGGGTCTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020019.1-52s1c1
Sequence:CCGGGCTCAACAGGAATCAGACAATCTCGAGATTGTCTGATTCCTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005363
MAGEA6 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005363.2-611s1c1
Sequence:CCGGCGTCGGAAATTGGCAGTACTTCTCGAGAAGTACTGCCAATTTCCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-761s1c1
Sequence:CCGGGCTGGGTGACAATCAGATCATCTCGAGATGATCTGATTGTCACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005363.2-934s1c1
Sequence:CCGGCCCAATATTTCGTGCAGGAAACTCGAGTTTCCTGCACGAAATATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-636s1c1
Sequence:CCGGCCTGTGATCTTCAGCAAAGCTCTCGAGAGCTTTGCTGAAGATCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005363.2-1462s1c1
Sequence:CCGGGATTGGGAAATCCATTCCATTCTCGAGAATGGAATGGATTTCCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-626s1c1
Sequence:CCGGGTACTTCTTTCCTGTGATCTTCTCGAGAAGATCACAGGAAAGAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005363.2-319s1c1
Sequence:CCGGCTTCTACTCTAGTTGAAGTCACTCGAGTGACTTCAACTAGAGTAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-1028s1c1
Sequence:CCGGCATTGAAACCAGCTATGTGAACTCGAGTTCACATAGCTGGTTTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005363.2-1241s1c1
Sequence:CCGGGCCCATTCTTCACTCTTTGAACTCGAGTTCAAAGAGTGAAGAATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-797s1c1
Sequence:CCGGCCTGATAATCATCCTGGCCATCTCGAGATGGCCAGGATGATTATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005363
MAGEA6 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005363.2-611s1c1
Sequence:CCGGCGTCGGAAATTGGCAGTACTTCTCGAGAAGTACTGCCAATTTCCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-761s1c1
Sequence:CCGGGCTGGGTGACAATCAGATCATCTCGAGATGATCTGATTGTCACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005363.2-934s1c1
Sequence:CCGGCCCAATATTTCGTGCAGGAAACTCGAGTTTCCTGCACGAAATATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-636s1c1
Sequence:CCGGCCTGTGATCTTCAGCAAAGCTCTCGAGAGCTTTGCTGAAGATCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005363.2-1462s1c1
Sequence:CCGGGATTGGGAAATCCATTCCATTCTCGAGAATGGAATGGATTTCCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-626s1c1
Sequence:CCGGGTACTTCTTTCCTGTGATCTTCTCGAGAAGATCACAGGAAAGAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005363.2-319s1c1
Sequence:CCGGCTTCTACTCTAGTTGAAGTCACTCGAGTGACTTCAACTAGAGTAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-1028s1c1
Sequence:CCGGCATTGAAACCAGCTATGTGAACTCGAGTTCACATAGCTGGTTTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005363.2-1241s1c1
Sequence:CCGGGCCCATTCTTCACTCTTTGAACTCGAGTTCAAAGAGTGAAGAATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-797s1c1
Sequence:CCGGCCTGATAATCATCCTGGCCATCTCGAGATGGCCAGGATGATTATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005363
MAGEA6 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005363.2-611s1c1
Sequence:CCGGCGTCGGAAATTGGCAGTACTTCTCGAGAAGTACTGCCAATTTCCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-761s1c1
Sequence:CCGGGCTGGGTGACAATCAGATCATCTCGAGATGATCTGATTGTCACCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005363.2-934s1c1
Sequence:CCGGCCCAATATTTCGTGCAGGAAACTCGAGTTTCCTGCACGAAATATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-636s1c1
Sequence:CCGGCCTGTGATCTTCAGCAAAGCTCTCGAGAGCTTTGCTGAAGATCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005363.2-1462s1c1
Sequence:CCGGGATTGGGAAATCCATTCCATTCTCGAGAATGGAATGGATTTCCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-626s1c1
Sequence:CCGGGTACTTCTTTCCTGTGATCTTCTCGAGAAGATCACAGGAAAGAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005363.2-319s1c1
Sequence:CCGGCTTCTACTCTAGTTGAAGTCACTCGAGTGACTTCAACTAGAGTAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-1028s1c1
Sequence:CCGGCATTGAAACCAGCTATGTGAACTCGAGTTCACATAGCTGGTTTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005363.2-1241s1c1
Sequence:CCGGGCCCATTCTTCACTCTTTGAACTCGAGTTCAAAGAGTGAAGAATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005363.2-797s1c1
Sequence:CCGGCCTGATAATCATCCTGGCCATCTCGAGATGGCCAGGATGATTATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)