EMAIL THIS PAGE TO A FRIEND

MAGEA8

melanoma antigen family A, 8

28 Gene Product Result for
Synonyms: CT1.8 MAGE8
UniProtKB ID: P43361, Q9BUN9
Gene ID:
Human(4107) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2009]
Mouse(17144) melanoma antigen, family A, 8
Rat(302638) melanoma antigen, family A, 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005364 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005364 Rosetta Predictions human pricing
XM_228890 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136874 predicted 1432
2 SASI_Hs01_00136875 predicted 1419
3 SASI_Hs01_00136876 predicted 371
4 SASI_Hs01_00136877 predicted 657
5 SASI_Hs01_00136878 predicted 1129
6 SASI_Hs01_00136879 predicted 1446
7 SASI_Hs01_00136881 predicted 276
8 SASI_Hs01_00136880 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385615 predicted 592
2 SASI_Rn02_00385616 predicted 619
3 SASI_Rn02_00385617 predicted 439
4 SASI_Rn02_00385618 predicted 738
5 SASI_Rn02_00385619 predicted 640
6 SASI_Rn02_00385620 predicted 373
7 SASI_Rn02_00385621 predicted 221
8 SASI_Rn02_00385622 predicted 654
9 SASI_Rn02_00385623 predicted 624
10 SASI_Rn02_00385624 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020020
MAGEA8 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 8
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-119s1c1
Sequence:CCGGCCTCAAATAAAGTGTATGGTACTCGAGTACCATACACTTTATTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-654s1c1
Sequence:CCGGTGGTGGGAGGAATCCTTACATCTCGAGATGTAAGGATTCCTCCCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-743s1c1
Sequence:CCGGTGCCCAATAGTGATCCTCCTACTCGAGTAGGAGGATCACTATTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-510s1c1
Sequence:CCGGGATCACCTATGATGGCATGATCTCGAGATCATGCCATCATAGGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-660s1c1
Sequence:CCGGGAGGAATCCTTACATACATAACTCGAGTTATGTATGTAAGGATTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020020.3-1356s21c1
Sequence:CCGGGAGAGCATAACACATTCAATTCTCGAGAATTGAATGTGTTATGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020020.3-1190s21c1
Sequence:CCGGAGGCATTGCAAGATGAGATAGCTCGAGCTATCTCATCTTGCAATGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020020
MAGEA8 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 8
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-119s1c1
Sequence:CCGGCCTCAAATAAAGTGTATGGTACTCGAGTACCATACACTTTATTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-654s1c1
Sequence:CCGGTGGTGGGAGGAATCCTTACATCTCGAGATGTAAGGATTCCTCCCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-743s1c1
Sequence:CCGGTGCCCAATAGTGATCCTCCTACTCGAGTAGGAGGATCACTATTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-510s1c1
Sequence:CCGGGATCACCTATGATGGCATGATCTCGAGATCATGCCATCATAGGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-660s1c1
Sequence:CCGGGAGGAATCCTTACATACATAACTCGAGTTATGTATGTAAGGATTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020020.3-1356s21c1
Sequence:CCGGGAGAGCATAACACATTCAATTCTCGAGAATTGAATGTGTTATGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020020.3-1190s21c1
Sequence:CCGGAGGCATTGCAAGATGAGATAGCTCGAGCTATCTCATCTTGCAATGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020020
MAGEA8 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 8
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-119s1c1
Sequence:CCGGCCTCAAATAAAGTGTATGGTACTCGAGTACCATACACTTTATTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-654s1c1
Sequence:CCGGTGGTGGGAGGAATCCTTACATCTCGAGATGTAAGGATTCCTCCCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-743s1c1
Sequence:CCGGTGCCCAATAGTGATCCTCCTACTCGAGTAGGAGGATCACTATTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-510s1c1
Sequence:CCGGGATCACCTATGATGGCATGATCTCGAGATCATGCCATCATAGGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020020.1-660s1c1
Sequence:CCGGGAGGAATCCTTACATACATAACTCGAGTTATGTATGTAAGGATTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020020.3-1356s21c1
Sequence:CCGGGAGAGCATAACACATTCAATTCTCGAGAATTGAATGTGTTATGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020020.3-1190s21c1
Sequence:CCGGAGGCATTGCAAGATGAGATAGCTCGAGCTATCTCATCTTGCAATGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005364
MAGEA8 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 8
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-839s1c1
Sequence:CCGGCCTGGGCATGATCTTAATGGACTCGAGTCCATTAAGATCATGCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005364.3-1275s1c1
Sequence:CCGGGCCCATTCTTCACTCTGTGTTCTCGAGAACACAGAGTGAAGAATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-698s1c1
Sequence:CCGGGCAGGTGATCTTTGGCATTGACTCGAGTCAATGCCAAAGATCACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-656s1c1
Sequence:CCGGGAACCACTTTCCTGATATCTTCTCGAGAAGATATCAGGAAAGTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-653s1c1
Sequence:CCGGCAAGAACCACTTTCCTGATATCTCGAGATATCAGGAAAGTGGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005364.3-1435s1c1
Sequence:CCGGCCTTCTAATGGATGGTGTAATCTCGAGATTACACCATCCATTAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-1101s1c1
Sequence:CCGGGTCAATGCAAGAGTTCGCATTCTCGAGAATGCGAACTCTTGCATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-1111s1c1
Sequence:CCGGGAGTTCGCATTTCCTACCCATCTCGAGATGGGTAGGAAATGCGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005364.4-1692s21c1
Sequence:CCGGACATGAGATAAAGACATAAAGCTCGAGCTTTATGTCTTTATCTCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005364.4-746s21c1
Sequence:CCGGAGTGCATGCAGGTGATCTTTGCTCGAGCAAAGATCACCTGCATGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005364.4-639s21c1
Sequence:CCGGGCTCCGCAAATATCAAATTAACTCGAGTTAATTTGATATTTGCGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005364
MAGEA8 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 8
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-839s1c1
Sequence:CCGGCCTGGGCATGATCTTAATGGACTCGAGTCCATTAAGATCATGCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005364.3-1275s1c1
Sequence:CCGGGCCCATTCTTCACTCTGTGTTCTCGAGAACACAGAGTGAAGAATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-698s1c1
Sequence:CCGGGCAGGTGATCTTTGGCATTGACTCGAGTCAATGCCAAAGATCACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-656s1c1
Sequence:CCGGGAACCACTTTCCTGATATCTTCTCGAGAAGATATCAGGAAAGTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-653s1c1
Sequence:CCGGCAAGAACCACTTTCCTGATATCTCGAGATATCAGGAAAGTGGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005364.3-1435s1c1
Sequence:CCGGCCTTCTAATGGATGGTGTAATCTCGAGATTACACCATCCATTAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-1101s1c1
Sequence:CCGGGTCAATGCAAGAGTTCGCATTCTCGAGAATGCGAACTCTTGCATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-1111s1c1
Sequence:CCGGGAGTTCGCATTTCCTACCCATCTCGAGATGGGTAGGAAATGCGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005364.4-1692s21c1
Sequence:CCGGACATGAGATAAAGACATAAAGCTCGAGCTTTATGTCTTTATCTCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005364.4-746s21c1
Sequence:CCGGAGTGCATGCAGGTGATCTTTGCTCGAGCAAAGATCACCTGCATGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005364.4-639s21c1
Sequence:CCGGGCTCCGCAAATATCAAATTAACTCGAGTTAATTTGATATTTGCGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005364
MAGEA8 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 8
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-839s1c1
Sequence:CCGGCCTGGGCATGATCTTAATGGACTCGAGTCCATTAAGATCATGCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005364.3-1275s1c1
Sequence:CCGGGCCCATTCTTCACTCTGTGTTCTCGAGAACACAGAGTGAAGAATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-698s1c1
Sequence:CCGGGCAGGTGATCTTTGGCATTGACTCGAGTCAATGCCAAAGATCACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-656s1c1
Sequence:CCGGGAACCACTTTCCTGATATCTTCTCGAGAAGATATCAGGAAAGTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-653s1c1
Sequence:CCGGCAAGAACCACTTTCCTGATATCTCGAGATATCAGGAAAGTGGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005364.3-1435s1c1
Sequence:CCGGCCTTCTAATGGATGGTGTAATCTCGAGATTACACCATCCATTAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-1101s1c1
Sequence:CCGGGTCAATGCAAGAGTTCGCATTCTCGAGAATGCGAACTCTTGCATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005364.3-1111s1c1
Sequence:CCGGGAGTTCGCATTTCCTACCCATCTCGAGATGGGTAGGAAATGCGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005364.4-1692s21c1
Sequence:CCGGACATGAGATAAAGACATAAAGCTCGAGCTTTATGTCTTTATCTCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005364.4-746s21c1
Sequence:CCGGAGTGCATGCAGGTGATCTTTGCTCGAGCAAAGATCACCTGCATGCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005364.4-639s21c1
Sequence:CCGGGCTCCGCAAATATCAAATTAACTCGAGTTAATTTGATATTTGCGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)