EMAIL THIS PAGE TO A FRIEND

MAGEA9

melanoma antigen family A, 9

42 Gene Product Result for
Synonyms: CT1.9 MAGE9
UniProtKB ID: P43362, A8K8A7, Q7Z5K4, Q92910
Gene ID:
Human(4108) Summary: This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. [provided by RefSeq, Jul 2008]
Rat(309261) melanoma antigen, family A, 9
cow(525400) melanoma antigen family A, 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005365 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005365 Rosetta Predictions human pricing
XM_001053679 Rosetta Predictions rat pricing
XM_219729 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222152 predicted 924
2 SASI_Hs01_00222153 predicted 1483
3 SASI_Hs01_00222154 predicted 1508
4 SASI_Hs01_00222155 predicted 1110
5 SASI_Hs01_00222156 predicted 1114
6 SASI_Hs01_00222157 predicted 1129
7 SASI_Hs01_00222158 predicted 1117
8 SASI_Hs01_00222159 predicted 1505
9 SASI_Hs01_00222160 predicted 1475
10 SASI_Hs01_00222161 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273150 predicted 307
2 SASI_Rn02_00273151 predicted 519
3 SASI_Rn02_00273152 predicted 627
4 SASI_Rn02_00273153 predicted 197
5 SASI_Rn02_00273154 predicted 660
6 SASI_Rn02_00273155 predicted 692
7 SASI_Rn02_00273156 predicted 195
8 SASI_Rn02_00273157 predicted 414
9 SASI_Rn02_00273158 predicted 328
10 SASI_Rn02_00273159 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378649 predicted 305
2 SASI_Rn02_00378650 predicted 524
3 SASI_Rn02_00378651 predicted 629
4 SASI_Rn02_00378652 predicted 202
5 SASI_Rn02_00378653 predicted 667
6 SASI_Rn02_00378654 predicted 700
7 SASI_Rn02_00378655 predicted 194
8 SASI_Rn02_00378656 predicted 411
9 SASI_Rn02_00378657 predicted 331
10 SASI_Rn02_00378658 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005365
MAGEA9 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005365.4-1599s1c1
Sequence:CCGGCAAGATAACATAGCAGAGGAACTCGAGTTCCTCTGCTATGTTATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-484s1c1
Sequence:CCGGCATTTCCGTCTACTACACTTTCTCGAGAAAGTGTAGTAGACGGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-709s1c1
Sequence:CCGGGCGCTACTTTCCTGTGATCTTCTCGAGAAGATCACAGGAAAGTAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-317s1c1
Sequence:CCGGGATGAAGACCTTGAAGCCCAACTCGAGTTGGGCTTCAAGGTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-1111s1c1
Sequence:CCGGCGCTGAAACCAGCTATGAGAACTCGAGTTCTCATAGCTGGTTTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005365.4-1489s1c1
Sequence:CCGGCGAAGTTAATGAATGACAGTACTCGAGTACTGTCATTCATTAACTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005365.4-1307s1c1
Sequence:CCGGCCCATTCTTCGCTCTGTGTTTCTCGAGAAACACAGAGCGAAGAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-478s1c1
Sequence:CCGGCTCCTCCATTTCCGTCTACTACTCGAGTAGTAGACGGAAATGGAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-599s1c1
Sequence:CCGGGCACTGAAATTGAAGGTGGCTCTCGAGAGCCACCTTCAATTTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005365
MAGEA9 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005365.4-1599s1c1
Sequence:CCGGCAAGATAACATAGCAGAGGAACTCGAGTTCCTCTGCTATGTTATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-484s1c1
Sequence:CCGGCATTTCCGTCTACTACACTTTCTCGAGAAAGTGTAGTAGACGGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-709s1c1
Sequence:CCGGGCGCTACTTTCCTGTGATCTTCTCGAGAAGATCACAGGAAAGTAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-317s1c1
Sequence:CCGGGATGAAGACCTTGAAGCCCAACTCGAGTTGGGCTTCAAGGTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-1111s1c1
Sequence:CCGGCGCTGAAACCAGCTATGAGAACTCGAGTTCTCATAGCTGGTTTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005365.4-1489s1c1
Sequence:CCGGCGAAGTTAATGAATGACAGTACTCGAGTACTGTCATTCATTAACTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005365.4-1307s1c1
Sequence:CCGGCCCATTCTTCGCTCTGTGTTTCTCGAGAAACACAGAGCGAAGAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-478s1c1
Sequence:CCGGCTCCTCCATTTCCGTCTACTACTCGAGTAGTAGACGGAAATGGAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-599s1c1
Sequence:CCGGGCACTGAAATTGAAGGTGGCTCTCGAGAGCCACCTTCAATTTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005365
MAGEA9 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005365.4-1599s1c1
Sequence:CCGGCAAGATAACATAGCAGAGGAACTCGAGTTCCTCTGCTATGTTATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-484s1c1
Sequence:CCGGCATTTCCGTCTACTACACTTTCTCGAGAAAGTGTAGTAGACGGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-709s1c1
Sequence:CCGGGCGCTACTTTCCTGTGATCTTCTCGAGAAGATCACAGGAAAGTAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-317s1c1
Sequence:CCGGGATGAAGACCTTGAAGCCCAACTCGAGTTGGGCTTCAAGGTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-1111s1c1
Sequence:CCGGCGCTGAAACCAGCTATGAGAACTCGAGTTCTCATAGCTGGTTTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005365.4-1489s1c1
Sequence:CCGGCGAAGTTAATGAATGACAGTACTCGAGTACTGTCATTCATTAACTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005365.4-1307s1c1
Sequence:CCGGCCCATTCTTCGCTCTGTGTTTCTCGAGAAACACAGAGCGAAGAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-478s1c1
Sequence:CCGGCTCCTCCATTTCCGTCTACTACTCGAGTAGTAGACGGAAATGGAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005365.4-599s1c1
Sequence:CCGGGCACTGAAATTGAAGGTGGCTCTCGAGAGCCACCTTCAATTTCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)