EMAIL THIS PAGE TO A FRIEND

MAGEA9B

melanoma antigen family A, 9B

13 Gene Product Result for
Gene ID:
Human(728269) Summary: MAGEA9B is a duplication of the MAGEA9 gene (MIM 300342) on chromosome Xq28. The 2 copies are separated by about 194 kb (Hartz, 2009).[supplied by OMIM, Mar 2009]
dog(492226) melanoma antigen family A, 9B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080790 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221281 MISSION® esiRNA esiRNA targeting human MAGEA9B human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080790 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315980 predicted 932
2 SASI_Hs02_00315981 predicted 1483
3 SASI_Hs02_00315982 predicted 1519
4 SASI_Hs02_00315983 predicted 1123
5 SASI_Hs02_00315984 predicted 1127
6 SASI_Hs02_00315985 predicted 1130
7 SASI_Hs02_00315986 predicted 1126
8 SASI_Hs02_00315987 predicted 1513
9 SASI_Hs02_00315988 predicted 1479
10 SASI_Hs02_00315989 predicted 635
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080790
MAGEA9B MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family A, 9B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-848s21c1
Sequence:CCGGCATGCTGGGTGATGGTCATAGCTCGAGCTATGACCATCACCCAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-636s21c1
Sequence:CCGGCATTTCCTGCTCCACAAATATCTCGAGATATTTGTGGAGCAGGAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-492s21c1
Sequence:CCGGATTTCCGTCTACTACACTTTACTCGAGTAAAGTGTAGTAGACGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-668s21c1
Sequence:CCGGGCCGGTCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080790.1-1412s21c1
Sequence:CCGGTTGGGTGATTTGGAGATTTATCTCGAGATAAATCTCCAAATCACCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080790
MAGEA9B MISSION shRNA shRNA Plasmid DNA
melanoma antigen family A, 9B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-848s21c1
Sequence:CCGGCATGCTGGGTGATGGTCATAGCTCGAGCTATGACCATCACCCAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-636s21c1
Sequence:CCGGCATTTCCTGCTCCACAAATATCTCGAGATATTTGTGGAGCAGGAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-492s21c1
Sequence:CCGGATTTCCGTCTACTACACTTTACTCGAGTAAAGTGTAGTAGACGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-668s21c1
Sequence:CCGGGCCGGTCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080790.1-1412s21c1
Sequence:CCGGTTGGGTGATTTGGAGATTTATCTCGAGATAAATCTCCAAATCACCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080790
MAGEA9B MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family A, 9B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-848s21c1
Sequence:CCGGCATGCTGGGTGATGGTCATAGCTCGAGCTATGACCATCACCCAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-636s21c1
Sequence:CCGGCATTTCCTGCTCCACAAATATCTCGAGATATTTGTGGAGCAGGAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-492s21c1
Sequence:CCGGATTTCCGTCTACTACACTTTACTCGAGTAAAGTGTAGTAGACGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080790.1-668s21c1
Sequence:CCGGGCCGGTCACAAAGGCAGAAATCTCGAGATTTCTGCCTTTGTGACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080790.1-1412s21c1
Sequence:CCGGTTGGGTGATTTGGAGATTTATCTCGAGATAAATCTCCAAATCACCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)