EMAIL THIS PAGE TO A FRIEND

MAGEB10

melanoma antigen family B, 10

27 Gene Product Result for
UniProtKB ID: Q96LZ2, Q494Y6, Q494Y7, Q9BZ78
Gene ID:
Human(139422) Summary: This gene encodes a member of the B subfamily of the melanoma associated antigen protein family. The encoded protein is specifically expressed in testis and tumor cells. [provided by RefSeq, Apr 2010]
dog(403710) melanoma antigen family B, 10
cow(529626) melanoma antigen family B, 10
dog(491794) melanoma antigen family B, 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182506 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182506 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141558 predicted 1139
2 SASI_Hs01_00141559 predicted 921
3 SASI_Hs01_00141560 predicted 928
4 SASI_Hs01_00141561 predicted 670
5 SASI_Hs01_00141562 predicted 771
6 SASI_Hs01_00141564 predicted 1338
7 SASI_Hs01_00141565 predicted 741
8 SASI_Hs01_00141566 predicted 632
9 SASI_Hs01_00141567 predicted 494
10 SASI_Hs02_00370566 predicted 1128
11 SASI_Hs01_00141563 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182506
MAGEB10 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182506.2-1346s21c1
Sequence:CCGGGGAGACAACACAGTGAATAATCTCGAGATTATTCACTGTGTTGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182506.1-1507s1c1
Sequence:CCGGGTGAGATTAAGAGTAAGCGATCTCGAGATCGCTTACTCTTAATCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-1224s21c1
Sequence:CCGGGGTGCACGTTCCAAGGTTAAGCTCGAGCTTAACCTTGGAACGTGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182506.1-656s1c1
Sequence:CCGGGCTGAGAAATGTAACCCAAATCTCGAGATTTGGGTTACATTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-839s21c1
Sequence:CCGGGATGACTGTCCTGGGTATTATCTCGAGATAATACCCAGGACAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-731s21c1
Sequence:CCGGGAAGGAAGTGGAGCCTAATAACTCGAGTTATTAGGCTCCACTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-891s21c1
Sequence:CCGGGAAGTCTGGAAAGTGTTTAACCTCGAGGTTAAACACTTTCCAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182506.1-986s1c1
Sequence:CCGGCCTTACCAAAGATTTGGTGAACTCGAGTTCACCAAATCTTTGGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182506.1-1581s1c1
Sequence:CCGGCACGATAGCATGGTAGTAAATCTCGAGATTTACTACCATGCTATCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-476s21c1
Sequence:CCGGCGAAGGAGTCAACGACCAAATCTCGAGATTTGGTCGTTGACTCCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182506
MAGEB10 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182506.2-1346s21c1
Sequence:CCGGGGAGACAACACAGTGAATAATCTCGAGATTATTCACTGTGTTGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182506.1-1507s1c1
Sequence:CCGGGTGAGATTAAGAGTAAGCGATCTCGAGATCGCTTACTCTTAATCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-1224s21c1
Sequence:CCGGGGTGCACGTTCCAAGGTTAAGCTCGAGCTTAACCTTGGAACGTGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182506.1-656s1c1
Sequence:CCGGGCTGAGAAATGTAACCCAAATCTCGAGATTTGGGTTACATTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-839s21c1
Sequence:CCGGGATGACTGTCCTGGGTATTATCTCGAGATAATACCCAGGACAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-731s21c1
Sequence:CCGGGAAGGAAGTGGAGCCTAATAACTCGAGTTATTAGGCTCCACTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-891s21c1
Sequence:CCGGGAAGTCTGGAAAGTGTTTAACCTCGAGGTTAAACACTTTCCAGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182506.1-986s1c1
Sequence:CCGGCCTTACCAAAGATTTGGTGAACTCGAGTTCACCAAATCTTTGGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182506.1-1581s1c1
Sequence:CCGGCACGATAGCATGGTAGTAAATCTCGAGATTTACTACCATGCTATCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-476s21c1
Sequence:CCGGCGAAGGAGTCAACGACCAAATCTCGAGATTTGGTCGTTGACTCCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182506
MAGEB10 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182506.2-1346s21c1
Sequence:CCGGGGAGACAACACAGTGAATAATCTCGAGATTATTCACTGTGTTGTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182506.1-1507s1c1
Sequence:CCGGGTGAGATTAAGAGTAAGCGATCTCGAGATCGCTTACTCTTAATCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-1224s21c1
Sequence:CCGGGGTGCACGTTCCAAGGTTAAGCTCGAGCTTAACCTTGGAACGTGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182506.1-656s1c1
Sequence:CCGGGCTGAGAAATGTAACCCAAATCTCGAGATTTGGGTTACATTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-839s21c1
Sequence:CCGGGATGACTGTCCTGGGTATTATCTCGAGATAATACCCAGGACAGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-731s21c1
Sequence:CCGGGAAGGAAGTGGAGCCTAATAACTCGAGTTATTAGGCTCCACTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-891s21c1
Sequence:CCGGGAAGTCTGGAAAGTGTTTAACCTCGAGGTTAAACACTTTCCAGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182506.1-986s1c1
Sequence:CCGGCCTTACCAAAGATTTGGTGAACTCGAGTTCACCAAATCTTTGGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182506.1-1581s1c1
Sequence:CCGGCACGATAGCATGGTAGTAAATCTCGAGATTTACTACCATGCTATCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182506.2-476s21c1
Sequence:CCGGCGAAGGAGTCAACGACCAAATCTCGAGATTTGGTCGTTGACTCCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)