EMAIL THIS PAGE TO A FRIEND

MAGEB16

melanoma antigen family B, 16

79 Gene Product Result for
UniProtKB ID: A2A368, A8MU30
Gene ID:
Mouse(71967) melanoma antigen family B, 16
Rat(317274) melanoma antigen family B, 16
cow(539382) melanoma antigen family B, 16
cow(528275) melanoma antigen family B, 16
dog(491811) melanoma antigen family B, 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001113734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001113734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001113734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001099921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099921 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099921 Rosetta Predictions human pricing
NM_001025013 Rosetta Predictions rat pricing
NM_001113734 Rosetta Predictions mouse pricing
NM_028025 Rosetta Predictions mouse pricing
XM_135953 Rosetta Predictions mouse pricing
XM_893039 Rosetta Predictions mouse pricing
XM_900554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321584 predicted 972
2 SASI_Hs02_00321585 predicted 1242
3 SASI_Hs02_00321586 predicted 744
4 SASI_Hs02_00321587 predicted 766
5 SASI_Hs02_00321588 predicted 1293
6 SASI_Hs02_00321589 predicted 675
7 SASI_Hs02_00321590 predicted 668
8 SASI_Hs02_00321591 predicted 957
9 SASI_Hs02_00321592 predicted 495
10 SASI_Hs02_00321593 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075825 predicted 374
2 SASI_Rn01_00075827 predicted 1216
3 SASI_Rn01_00075828 predicted 977
4 SASI_Rn01_00075829 predicted 770
5 SASI_Rn01_00075830 predicted 1041
6 SASI_Rn01_00075831 predicted 880
7 SASI_Rn01_00075832 predicted 1324
8 SASI_Rn01_00075833 predicted 554
9 SASI_Rn02_00202920 predicted 842
10 SASI_Rn01_00075834 predicted 1019
11 SASI_Rn01_00075826 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308289 predicted 1274
2 SASI_Mm02_00308290 predicted 1186
3 SASI_Mm02_00308291 predicted 693
4 SASI_Mm02_00308292 predicted 431
5 SASI_Mm02_00308293 predicted 467
6 SASI_Mm02_00308294 predicted 1326
7 SASI_Mm02_00308295 predicted 1330
8 SASI_Mm02_00308296 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333162 predicted 1408
2 SASI_Mm02_00333163 predicted 1315
3 SASI_Mm02_00333164 predicted 818
4 SASI_Mm02_00333165 predicted 558
5 SASI_Mm02_00333166 predicted 597
6 SASI_Mm02_00333167 predicted 1447
7 SASI_Mm02_00333168 predicted 1450
8 SASI_Mm02_00333169 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267853 predicted 639
2 SASI_Mm01_00267854 predicted 1410
3 SASI_Mm01_00267855 predicted 1149
4 SASI_Mm01_00267856 predicted 1135
5 SASI_Mm01_00267857 predicted 1313
6 SASI_Mm01_00267858 predicted 1260
7 SASI_Mm01_00267859 predicted 1273
8 SASI_Mm01_00267860 predicted 1208
9 SASI_Mm01_00267861 predicted 1390
10 SASI_Mm01_00267862 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272703 predicted 509
2 SASI_Mm01_00272704 predicted 1282
3 SASI_Mm01_00272705 predicted 1014
4 SASI_Mm01_00272706 predicted 998
5 SASI_Mm01_00272707 predicted 1183
6 SASI_Mm01_00272708 predicted 1131
7 SASI_Mm01_00272709 predicted 1149
8 SASI_Mm01_00272710 predicted 1084
9 SASI_Mm01_00272711 predicted 1261
10 SASI_Mm01_00272712 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207339 predicted 358
2 SASI_Mm01_00207340 predicted 515
3 SASI_Mm01_00207341 predicted 462
4 SASI_Mm01_00207342 predicted 320
5 SASI_Mm01_00207343 predicted 519
6 SASI_Mm01_00207344 predicted 304
7 SASI_Mm01_00207345 predicted 332
8 SASI_Mm01_00207346 predicted 425
9 SASI_Mm01_00207347 predicted 465
10 SASI_Mm01_00207348 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001113734
MAGEB16 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-1202s21c1
Sequence:CCGGATGCTGATTCAAGTTCTACTTCTCGAGAAGTAGAACTTGAATCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-467s21c1
Sequence:CCGGAGTCTACTGAGGATCTTGATGCTCGAGCATCAAGATCCTCAGTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-1251s21c1
Sequence:CCGGCAACTTCTCTCAGGTCTAGTACTCGAGTACTAGACCTGAGAGAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-1191s21c1
Sequence:CCGGGCTATTAGAGCATGCTGATTCCTCGAGGAATCAGCATGCTCTAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113734.1-1332s21c1
Sequence:CCGGATGTACGACCTAGATTGTATACTCGAGTATACAATCTAGGTCGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001113734
MAGEB16 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-1202s21c1
Sequence:CCGGATGCTGATTCAAGTTCTACTTCTCGAGAAGTAGAACTTGAATCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-467s21c1
Sequence:CCGGAGTCTACTGAGGATCTTGATGCTCGAGCATCAAGATCCTCAGTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-1251s21c1
Sequence:CCGGCAACTTCTCTCAGGTCTAGTACTCGAGTACTAGACCTGAGAGAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-1191s21c1
Sequence:CCGGGCTATTAGAGCATGCTGATTCCTCGAGGAATCAGCATGCTCTAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113734.1-1332s21c1
Sequence:CCGGATGTACGACCTAGATTGTATACTCGAGTATACAATCTAGGTCGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001113734
MAGEB16 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-1202s21c1
Sequence:CCGGATGCTGATTCAAGTTCTACTTCTCGAGAAGTAGAACTTGAATCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-467s21c1
Sequence:CCGGAGTCTACTGAGGATCTTGATGCTCGAGCATCAAGATCCTCAGTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-1251s21c1
Sequence:CCGGCAACTTCTCTCAGGTCTAGTACTCGAGTACTAGACCTGAGAGAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113734.1-1191s21c1
Sequence:CCGGGCTATTAGAGCATGCTGATTCCTCGAGGAATCAGCATGCTCTAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113734.1-1332s21c1
Sequence:CCGGATGTACGACCTAGATTGTATACTCGAGTATACAATCTAGGTCGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099921
MAGEB16 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-1162s21c1
Sequence:CCGGGCCAAAGTTCATGGGTCTTACCTCGAGGTAAGACCCATGAACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-965s21c1
Sequence:CCGGTGAATTTGACGGGAGTATATTCTCGAGAATATACTCCCGTCAAATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099921.1-1621s21c1
Sequence:CCGGAGATTGGGAAACCATCTATATCTCGAGATATAGATGGTTTCCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-688s21c1
Sequence:CCGGGCAGATATGTTGAAGATTATCCTCGAGGATAATCTTCAACATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-757s21c1
Sequence:CCGGGAGCACCTAGAGATGATATTTCTCGAGAAATATCATCTCTAGGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099921
MAGEB16 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-1162s21c1
Sequence:CCGGGCCAAAGTTCATGGGTCTTACCTCGAGGTAAGACCCATGAACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-965s21c1
Sequence:CCGGTGAATTTGACGGGAGTATATTCTCGAGAATATACTCCCGTCAAATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099921.1-1621s21c1
Sequence:CCGGAGATTGGGAAACCATCTATATCTCGAGATATAGATGGTTTCCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-688s21c1
Sequence:CCGGGCAGATATGTTGAAGATTATCCTCGAGGATAATCTTCAACATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-757s21c1
Sequence:CCGGGAGCACCTAGAGATGATATTTCTCGAGAAATATCATCTCTAGGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099921
MAGEB16 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-1162s21c1
Sequence:CCGGGCCAAAGTTCATGGGTCTTACCTCGAGGTAAGACCCATGAACTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-965s21c1
Sequence:CCGGTGAATTTGACGGGAGTATATTCTCGAGAATATACTCCCGTCAAATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099921.1-1621s21c1
Sequence:CCGGAGATTGGGAAACCATCTATATCTCGAGATATAGATGGTTTCCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-688s21c1
Sequence:CCGGGCAGATATGTTGAAGATTATCCTCGAGGATAATCTTCAACATATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099921.1-757s21c1
Sequence:CCGGGAGCACCTAGAGATGATATTTCTCGAGAAATATCATCTCTAGGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)