EMAIL THIS PAGE TO A FRIEND

MAGEB18

melanoma antigen family B, 18

79 Gene Product Result for
UniProtKB ID: Q96M61
Gene ID:
Mouse(215641) melanoma antigen family B, 18
Rat(317270) melanoma antigen family B, 18
dog(491786) melanoma antigen family B, 18
cow(532174) melanoma antigen family B, 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173699 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058671 MISSION® esiRNA esiRNA human MAGEB18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173699 Rosetta Predictions human pricing
NM_001044246 Rosetta Predictions rat pricing
NM_173783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244170 predicted 308
2 SASI_Hs01_00244171 predicted 913
3 SASI_Hs01_00244172 predicted 555
4 SASI_Hs01_00244173 predicted 578
5 SASI_Hs01_00244174 predicted 570
6 SASI_Hs01_00244175 predicted 659
7 SASI_Hs01_00244176 predicted 563
8 SASI_Hs01_00244177 predicted 558
9 SASI_Hs01_00244178 predicted 918
10 SASI_Hs01_00244179 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205187 predicted 1150
2 SASI_Rn02_00205188 predicted 748
3 SASI_Rn02_00205189 predicted 764
4 SASI_Rn02_00205190 predicted 802
5 SASI_Rn02_00205191 predicted 512
6 SASI_Rn02_00205192 predicted 1161
7 SASI_Rn02_00205193 predicted 395
8 SASI_Rn02_00205194 predicted 254
9 SASI_Rn02_00205195 predicted 821
10 SASI_Rn02_00205196 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072498 predicted 1018
2 SASI_Mm01_00072499 predicted 1030
3 SASI_Mm01_00072500 predicted 966
4 SASI_Mm01_00072501 predicted 830
5 SASI_Mm01_00072502 predicted 497
6 SASI_Mm01_00072503 predicted 1258
7 SASI_Mm01_00072504 predicted 1324
8 SASI_Mm01_00072505 predicted 663
9 SASI_Mm01_00072506 predicted 1422
10 SASI_Mm01_00072507 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173699
MAGEB18 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 18
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000139666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-1039s1c1
Sequence:CCGGCCTGGAGTTTGTAGCCAAGATCTCGAGATCTTGGCTACAAACTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-1086s1c1
Sequence:CCGGCATCCTGCTATGAAGAGGCTTCTCGAGAAGCCTCTTCATAGCAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1636s1c1
Sequence:CCGGGTGAGATGATTTAGCAGTAAACTCGAGTTTACTGCTAAATCATCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-541s1c1
Sequence:CCGGGCTTCAGAAGTATGAAACGAACTCGAGTTCGTTTCATACTTCTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1296s1c1
Sequence:CCGGGTGGAAGAGAAGAGCAGTCAACTCGAGTTGACTGCTCTTCTCTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-239s1c1
Sequence:CCGGGCTCGTTGTGAGAATCAGGATCTCGAGATCCTGATTCTCACAACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-399s1c1
Sequence:CCGGCCAATGCTATTGCACCTGTTTCTCGAGAAACAGGTGCAATAGCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1499s1c1
Sequence:CCGGGACTTTGGTTACACACGTATTCTCGAGAATACGTGTGTAACCAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-1040s1c1
Sequence:CCGGCTGGAGTTTGTAGCCAAGATACTCGAGTATCTTGGCTACAAACTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-658s1c1
Sequence:CCGGGCTGGCACTTGGTGTTGATTTCTCGAGAAATCAACACCAAGTGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1589s1c1
Sequence:CCGGCCAGAACAAGGAAACACAGTACTCGAGTACTGTGTTTCCTTGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1590s1c1
Sequence:CCGGCAGAACAAGGAAACACAGTATCTCGAGATACTGTGTTTCCTTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173699
MAGEB18 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 18
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000139666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-1039s1c1
Sequence:CCGGCCTGGAGTTTGTAGCCAAGATCTCGAGATCTTGGCTACAAACTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-1086s1c1
Sequence:CCGGCATCCTGCTATGAAGAGGCTTCTCGAGAAGCCTCTTCATAGCAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1636s1c1
Sequence:CCGGGTGAGATGATTTAGCAGTAAACTCGAGTTTACTGCTAAATCATCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-541s1c1
Sequence:CCGGGCTTCAGAAGTATGAAACGAACTCGAGTTCGTTTCATACTTCTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1296s1c1
Sequence:CCGGGTGGAAGAGAAGAGCAGTCAACTCGAGTTGACTGCTCTTCTCTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-239s1c1
Sequence:CCGGGCTCGTTGTGAGAATCAGGATCTCGAGATCCTGATTCTCACAACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-399s1c1
Sequence:CCGGCCAATGCTATTGCACCTGTTTCTCGAGAAACAGGTGCAATAGCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1499s1c1
Sequence:CCGGGACTTTGGTTACACACGTATTCTCGAGAATACGTGTGTAACCAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-1040s1c1
Sequence:CCGGCTGGAGTTTGTAGCCAAGATACTCGAGTATCTTGGCTACAAACTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-658s1c1
Sequence:CCGGGCTGGCACTTGGTGTTGATTTCTCGAGAAATCAACACCAAGTGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1589s1c1
Sequence:CCGGCCAGAACAAGGAAACACAGTACTCGAGTACTGTGTTTCCTTGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1590s1c1
Sequence:CCGGCAGAACAAGGAAACACAGTATCTCGAGATACTGTGTTTCCTTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173699
MAGEB18 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 18
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000139666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-1039s1c1
Sequence:CCGGCCTGGAGTTTGTAGCCAAGATCTCGAGATCTTGGCTACAAACTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-1086s1c1
Sequence:CCGGCATCCTGCTATGAAGAGGCTTCTCGAGAAGCCTCTTCATAGCAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1636s1c1
Sequence:CCGGGTGAGATGATTTAGCAGTAAACTCGAGTTTACTGCTAAATCATCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-541s1c1
Sequence:CCGGGCTTCAGAAGTATGAAACGAACTCGAGTTCGTTTCATACTTCTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1296s1c1
Sequence:CCGGGTGGAAGAGAAGAGCAGTCAACTCGAGTTGACTGCTCTTCTCTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-239s1c1
Sequence:CCGGGCTCGTTGTGAGAATCAGGATCTCGAGATCCTGATTCTCACAACGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-399s1c1
Sequence:CCGGCCAATGCTATTGCACCTGTTTCTCGAGAAACAGGTGCAATAGCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1499s1c1
Sequence:CCGGGACTTTGGTTACACACGTATTCTCGAGAATACGTGTGTAACCAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-1040s1c1
Sequence:CCGGCTGGAGTTTGTAGCCAAGATACTCGAGTATCTTGGCTACAAACTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173699.1-658s1c1
Sequence:CCGGGCTGGCACTTGGTGTTGATTTCTCGAGAAATCAACACCAAGTGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1589s1c1
Sequence:CCGGCCAGAACAAGGAAACACAGTACTCGAGTACTGTGTTTCCTTGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173699.1-1590s1c1
Sequence:CCGGCAGAACAAGGAAACACAGTATCTCGAGATACTGTGTTTCCTTGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173783
MAGEB18 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 18
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173783.2-1424s1c1
Sequence:CCGGGCTACCTAATAGTGGAAGGTTCTCGAGAACCTTCCACTATTAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-1102s1c1
Sequence:CCGGGCAGCTAAAGTACTTGGAGTACTCGAGTACTCCAAGTACTTTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-659s1c1
Sequence:CCGGGACTGGTGTAAAGATCCTATTCTCGAGAATAGGATCTTTACACCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-937s1c1
Sequence:CCGGGCCCAGTAGTGGCCTCCTAATCTCGAGATTAGGAGGCCACTACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-1021s1c1
Sequence:CCGGGCTGAGTATGATGGGTGTATACTCGAGTATACACCCATCATACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173783.3-522s21c1
Sequence:CCGGGCTAGTCCTGTTGCCAGTATGCTCGAGCATACTGGCAACAGGACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173783.3-1377s21c1
Sequence:CCGGACTAATATCTAAGGCTATTTCCTCGAGGAAATAGCCTTAGATATTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173783.3-1565s21c1
Sequence:CCGGGAAATTAGACAATGGACAATTCTCGAGAATTGTCCATTGTCTAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173783
MAGEB18 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 18
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173783.2-1424s1c1
Sequence:CCGGGCTACCTAATAGTGGAAGGTTCTCGAGAACCTTCCACTATTAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-1102s1c1
Sequence:CCGGGCAGCTAAAGTACTTGGAGTACTCGAGTACTCCAAGTACTTTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-659s1c1
Sequence:CCGGGACTGGTGTAAAGATCCTATTCTCGAGAATAGGATCTTTACACCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-937s1c1
Sequence:CCGGGCCCAGTAGTGGCCTCCTAATCTCGAGATTAGGAGGCCACTACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-1021s1c1
Sequence:CCGGGCTGAGTATGATGGGTGTATACTCGAGTATACACCCATCATACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173783.3-522s21c1
Sequence:CCGGGCTAGTCCTGTTGCCAGTATGCTCGAGCATACTGGCAACAGGACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173783.3-1377s21c1
Sequence:CCGGACTAATATCTAAGGCTATTTCCTCGAGGAAATAGCCTTAGATATTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173783.3-1565s21c1
Sequence:CCGGGAAATTAGACAATGGACAATTCTCGAGAATTGTCCATTGTCTAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173783
MAGEB18 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 18
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173783.2-1424s1c1
Sequence:CCGGGCTACCTAATAGTGGAAGGTTCTCGAGAACCTTCCACTATTAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-1102s1c1
Sequence:CCGGGCAGCTAAAGTACTTGGAGTACTCGAGTACTCCAAGTACTTTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-659s1c1
Sequence:CCGGGACTGGTGTAAAGATCCTATTCTCGAGAATAGGATCTTTACACCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-937s1c1
Sequence:CCGGGCCCAGTAGTGGCCTCCTAATCTCGAGATTAGGAGGCCACTACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173783.2-1021s1c1
Sequence:CCGGGCTGAGTATGATGGGTGTATACTCGAGTATACACCCATCATACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173783.3-522s21c1
Sequence:CCGGGCTAGTCCTGTTGCCAGTATGCTCGAGCATACTGGCAACAGGACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173783.3-1377s21c1
Sequence:CCGGACTAATATCTAAGGCTATTTCCTCGAGGAAATAGCCTTAGATATTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173783.3-1565s21c1
Sequence:CCGGGAAATTAGACAATGGACAATTCTCGAGAATTGTCCATTGTCTAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)