EMAIL THIS PAGE TO A FRIEND

MAGEB2

melanoma antigen family B, 2

58 Gene Product Result for
Synonyms: CT3.2 DAM6 MAGE-XP-2
UniProtKB ID: O15479, O75860
Gene ID:
Human(4113) Summary: This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. This gene is localized in the DSS (dosage-sensitive sex reversal) critical region. It is expressed in testis and placenta, and in a significant fraction of tumors of various histological types. The MAGEB genes are clustered on chromosome Xp22-p21. [provided by RefSeq, Jul 2008]
Mouse(17146) melanoma antigen, family B, 2
Rat(302744) melanoma antigen family B, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002364 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011381 MISSION® esiRNA esiRNA targeting human MAGEB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002364 Rosetta Predictions human pricing
XM_001061659 Rosetta Predictions rat pricing
XM_229036 Rosetta Predictions rat pricing
NM_031171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219671 predicted 485
2 SASI_Hs01_00219662 predicted 627
3 SASI_Hs01_00219663 predicted 1002
4 SASI_Hs01_00219664 predicted 384
5 SASI_Hs01_00219665 predicted 349
6 SASI_Hs01_00219666 predicted 620
7 SASI_Hs01_00219667 predicted 734
8 SASI_Hs01_00219668 predicted 767
9 SASI_Hs01_00219669 predicted 773
10 SASI_Hs01_00219670 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300916 predicted 1180
2 SASI_Rn02_00300917 predicted 410
3 SASI_Rn02_00300918 predicted 540
4 SASI_Rn02_00300919 predicted 908
5 SASI_Rn02_00300920 predicted 881
6 SASI_Rn02_00300921 predicted 483
7 SASI_Rn02_00300922 predicted 788
8 SASI_Rn02_00300923 predicted 427
9 SASI_Rn02_00300924 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385715 predicted 1218
2 SASI_Rn02_00385716 predicted 409
3 SASI_Rn02_00385717 predicted 536
4 SASI_Rn02_00385718 predicted 909
5 SASI_Rn02_00385719 predicted 882
6 SASI_Rn02_00385720 predicted 482
7 SASI_Rn02_00385721 predicted 788
8 SASI_Rn02_00385722 predicted 429
9 SASI_Rn02_00385723 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196895 predicted 367
2 SASI_Mm01_00196896 predicted 296
3 SASI_Mm02_00337001 predicted 745
4 SASI_Mm01_00196898 predicted 375
5 SASI_Mm01_00196899 predicted 359
6 SASI_Mm01_00196900 predicted 197
7 SASI_Mm01_00196901 predicted 311
8 SASI_Mm01_00196903 predicted 586
9 SASI_Mm01_00196904 predicted 494
10 SASI_Mm02_00337002 predicted 287
11 SASI_Mm01_00196897 predicted 627
12 SASI_Mm01_00196902 predicted 648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031171
MAGEB2 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031171.1-631s21c1
Sequence:CCGGGAGCAAGAGGTCTGGCAATTTCTCGAGAAATTGCCAGACCTCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031171.1-363s21c1
Sequence:CCGGAGCAGTTACAAGGAGTGAAATCTCGAGATTTCACTCCTTGTAACTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031171.1-513s21c1
Sequence:CCGGGGTAGGCAAACTGGGTCTTTCCTCGAGGAAAGACCCAGTTTGCCTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-336s1c1
Sequence:CCGGCCTGCTAGATAAGTTTAAGATCTCGAGATCTTAAACTTATCTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-703s1c1
Sequence:CCGGCCTGAGGAGTTTATAAGAGATCTCGAGATCTCTTATAAACTCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-811s1c1
Sequence:CCGGGCTGAAACAACCAAGATGAAACTCGAGTTTCATCTTGGTTGTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-445s1c1
Sequence:CCGGGCACGCCTAGAATTAGTCTTTCTCGAGAAAGACTAATTCTAGGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-388s1c1
Sequence:CCGGGCAGTAGTTAACAAGAAGTATCTCGAGATACTTCTTGTTAACTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031171
MAGEB2 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031171.1-631s21c1
Sequence:CCGGGAGCAAGAGGTCTGGCAATTTCTCGAGAAATTGCCAGACCTCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031171.1-363s21c1
Sequence:CCGGAGCAGTTACAAGGAGTGAAATCTCGAGATTTCACTCCTTGTAACTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031171.1-513s21c1
Sequence:CCGGGGTAGGCAAACTGGGTCTTTCCTCGAGGAAAGACCCAGTTTGCCTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-336s1c1
Sequence:CCGGCCTGCTAGATAAGTTTAAGATCTCGAGATCTTAAACTTATCTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-703s1c1
Sequence:CCGGCCTGAGGAGTTTATAAGAGATCTCGAGATCTCTTATAAACTCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-811s1c1
Sequence:CCGGGCTGAAACAACCAAGATGAAACTCGAGTTTCATCTTGGTTGTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-445s1c1
Sequence:CCGGGCACGCCTAGAATTAGTCTTTCTCGAGAAAGACTAATTCTAGGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-388s1c1
Sequence:CCGGGCAGTAGTTAACAAGAAGTATCTCGAGATACTTCTTGTTAACTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031171
MAGEB2 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031171.1-631s21c1
Sequence:CCGGGAGCAAGAGGTCTGGCAATTTCTCGAGAAATTGCCAGACCTCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031171.1-363s21c1
Sequence:CCGGAGCAGTTACAAGGAGTGAAATCTCGAGATTTCACTCCTTGTAACTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031171.1-513s21c1
Sequence:CCGGGGTAGGCAAACTGGGTCTTTCCTCGAGGAAAGACCCAGTTTGCCTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-336s1c1
Sequence:CCGGCCTGCTAGATAAGTTTAAGATCTCGAGATCTTAAACTTATCTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-703s1c1
Sequence:CCGGCCTGAGGAGTTTATAAGAGATCTCGAGATCTCTTATAAACTCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-811s1c1
Sequence:CCGGGCTGAAACAACCAAGATGAAACTCGAGTTTCATCTTGGTTGTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-445s1c1
Sequence:CCGGGCACGCCTAGAATTAGTCTTTCTCGAGAAAGACTAATTCTAGGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031171.1-388s1c1
Sequence:CCGGGCAGTAGTTAACAAGAAGTATCTCGAGATACTTCTTGTTAACTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002364
MAGEB2 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002364.4-1300s21c1
Sequence:CCGGTGATATAGATCACCCTGTTATCTCGAGATAACAGGGTGATCTATATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002364.4-1255s21c1
Sequence:CCGGAGTGTTTCAACAGGTTTATTTCTCGAGAAATAAACCTGTTGAAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002364.4-410s21c1
Sequence:CCGGACTAAGAGCCCAAGCGAAGATCTCGAGATCTTCGCTTGGGCTCTTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002364.3-1326s1c1
Sequence:CCGGCAGGGACAGTAGAAAGTGTTTCTCGAGAAACACTTTCTACTGTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002364.3-950s1c1
Sequence:CCGGCAAGATGAAAGTCCTGGAGTTCTCGAGAACTCCAGGACTTTCATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-397s1c1
Sequence:CCGGCAACATCTACTAAGAGCCCAACTCGAGTTGGGCTCTTAGTAGATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002364.3-1101s1c1
Sequence:CCGGCAATCTCCCAAAGCCAAGTTTCTCGAGAAACTTGGCTTTGGGAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-593s1c1
Sequence:CCGGCCTTGAGCTGAATAAAGTCAACTCGAGTTGACTTTATTCAGCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-488s1c1
Sequence:CCGGGTCCGTTACAAAGGGAGAAATCTCGAGATTTCTCCCTTTGTAACGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002364.3-719s1c1
Sequence:CCGGCCTGGGTGTGATCTTCTTAAACTCGAGTTTAAGAAGATCACACCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-1009s1c1
Sequence:CCGGCAACCCATTACGAAGAAGCTTCTCGAGAAGCTTCTTCGTAATGGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002364
MAGEB2 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002364.4-1300s21c1
Sequence:CCGGTGATATAGATCACCCTGTTATCTCGAGATAACAGGGTGATCTATATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002364.4-1255s21c1
Sequence:CCGGAGTGTTTCAACAGGTTTATTTCTCGAGAAATAAACCTGTTGAAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002364.4-410s21c1
Sequence:CCGGACTAAGAGCCCAAGCGAAGATCTCGAGATCTTCGCTTGGGCTCTTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002364.3-1326s1c1
Sequence:CCGGCAGGGACAGTAGAAAGTGTTTCTCGAGAAACACTTTCTACTGTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002364.3-950s1c1
Sequence:CCGGCAAGATGAAAGTCCTGGAGTTCTCGAGAACTCCAGGACTTTCATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-397s1c1
Sequence:CCGGCAACATCTACTAAGAGCCCAACTCGAGTTGGGCTCTTAGTAGATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002364.3-1101s1c1
Sequence:CCGGCAATCTCCCAAAGCCAAGTTTCTCGAGAAACTTGGCTTTGGGAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-593s1c1
Sequence:CCGGCCTTGAGCTGAATAAAGTCAACTCGAGTTGACTTTATTCAGCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-488s1c1
Sequence:CCGGGTCCGTTACAAAGGGAGAAATCTCGAGATTTCTCCCTTTGTAACGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002364.3-719s1c1
Sequence:CCGGCCTGGGTGTGATCTTCTTAAACTCGAGTTTAAGAAGATCACACCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-1009s1c1
Sequence:CCGGCAACCCATTACGAAGAAGCTTCTCGAGAAGCTTCTTCGTAATGGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002364
MAGEB2 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002364.4-1300s21c1
Sequence:CCGGTGATATAGATCACCCTGTTATCTCGAGATAACAGGGTGATCTATATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002364.4-1255s21c1
Sequence:CCGGAGTGTTTCAACAGGTTTATTTCTCGAGAAATAAACCTGTTGAAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002364.4-410s21c1
Sequence:CCGGACTAAGAGCCCAAGCGAAGATCTCGAGATCTTCGCTTGGGCTCTTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002364.3-1326s1c1
Sequence:CCGGCAGGGACAGTAGAAAGTGTTTCTCGAGAAACACTTTCTACTGTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002364.3-950s1c1
Sequence:CCGGCAAGATGAAAGTCCTGGAGTTCTCGAGAACTCCAGGACTTTCATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-397s1c1
Sequence:CCGGCAACATCTACTAAGAGCCCAACTCGAGTTGGGCTCTTAGTAGATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002364.3-1101s1c1
Sequence:CCGGCAATCTCCCAAAGCCAAGTTTCTCGAGAAACTTGGCTTTGGGAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-593s1c1
Sequence:CCGGCCTTGAGCTGAATAAAGTCAACTCGAGTTGACTTTATTCAGCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-488s1c1
Sequence:CCGGGTCCGTTACAAAGGGAGAAATCTCGAGATTTCTCCCTTTGTAACGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002364.3-719s1c1
Sequence:CCGGCCTGGGTGTGATCTTCTTAAACTCGAGTTTAAGAAGATCACACCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002364.3-1009s1c1
Sequence:CCGGCAACCCATTACGAAGAAGCTTCTCGAGAAGCTTCTTCGTAATGGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)