EMAIL THIS PAGE TO A FRIEND

MAGEB3

melanoma antigen family B, 3

48 Gene Product Result for
Synonyms: CT3.5
UniProtKB ID: O15480, A0AVE4, B3KQ52, O75861
Gene ID:
Human(4114) Summary: This gene is a MAGE-B subfamily member of the MAGE gene family. MAGE family member proteins direct the expression of tumor antigens recognized on a human melanoma by autologous cytolytic T lymphocytes. There are two known clusters of MAGE genes on chromosome X. The members of the MAGE-A subfamily are located in the Xq28 region, while the members of the MAGE-B subfamily are clustered in the Xp21 region. [provided by RefSeq, Jul 2008]
Mouse(17147) melanoma antigen, family B, 3
Rat(302746) melanoma antigen family B, 3
cow(509870) melanoma antigen family B, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002365 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002365 Rosetta Predictions human pricing
NM_001106965 Rosetta Predictions rat pricing
NM_008545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120072 predicted 1402
2 SASI_Hs01_00120073 predicted 1481
3 SASI_Hs01_00120074 predicted 1477
4 SASI_Hs01_00120075 predicted 1263
5 SASI_Hs01_00120076 predicted 940
6 SASI_Hs01_00120077 predicted 930
7 SASI_Hs01_00120078 predicted 1056
8 SASI_Hs01_00120080 predicted 1732
9 SASI_Hs01_00120081 predicted 1844
10 SASI_Hs02_00333703 predicted 1066
11 SASI_Hs01_00120079 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224156 predicted 527
2 SASI_Rn02_00224157 predicted 244
3 SASI_Rn02_00224158 predicted 725
4 SASI_Rn02_00224159 predicted 508
5 SASI_Rn02_00224160 predicted 631
6 SASI_Rn02_00224161 predicted 491
7 SASI_Rn02_00224162 predicted 761
8 SASI_Rn02_00224163 predicted 313
9 SASI_Rn02_00224164 predicted 396
10 SASI_Rn02_00224165 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107288 predicted 1208
2 SASI_Mm01_00107289 predicted 1164
3 SASI_Mm01_00107290 predicted 1366
4 SASI_Mm02_00314141 predicted 1236
5 SASI_Mm01_00107291 predicted 1243
6 SASI_Mm01_00107293 predicted 1247
7 SASI_Mm02_00314142 predicted 1719
8 SASI_Mm01_00107294 predicted 1160
9 SASI_Mm01_00107295 predicted 1244
10 SASI_Mm01_00107296 predicted 1141
11 SASI_Mm01_00107292 predicted 1521
12 SASI_Mm01_00107297 predicted 1852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002365
MAGEB3 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-1064s1c1
Sequence:CCGGCCCTCTAATCATGAAGACAAACTCGAGTTTGTCTTCATGATTAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-1485s1c1
Sequence:CCGGCAAGATTTGGTGAAGCTTAAACTCGAGTTTAAGCTTCACCAAATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-949s1c1
Sequence:CCGGCCACTACATCTGTAGATGTTTCTCGAGAAACATCTACAGATGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002365.3-1988s1c1
Sequence:CCGGCTGGTCACATTTGTTGTTTAACTCGAGTTAAACAACAAATGTGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-1219s1c1
Sequence:CCGGAGGTGGTATTTGGTGTTGATTCTCGAGAATCAACACCAAATACCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002365.4-1719s21c1
Sequence:CCGGAGTAGTGCCATGGGCAGAAAGCTCGAGCTTTCTGCCCATGGCACTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002365.4-2062s21c1
Sequence:CCGGTAGTGATCTGTTGCAAGATAACTCGAGTTATCTTGCAACAGATCACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002365
MAGEB3 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-1064s1c1
Sequence:CCGGCCCTCTAATCATGAAGACAAACTCGAGTTTGTCTTCATGATTAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-1485s1c1
Sequence:CCGGCAAGATTTGGTGAAGCTTAAACTCGAGTTTAAGCTTCACCAAATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-949s1c1
Sequence:CCGGCCACTACATCTGTAGATGTTTCTCGAGAAACATCTACAGATGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002365.3-1988s1c1
Sequence:CCGGCTGGTCACATTTGTTGTTTAACTCGAGTTAAACAACAAATGTGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-1219s1c1
Sequence:CCGGAGGTGGTATTTGGTGTTGATTCTCGAGAATCAACACCAAATACCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002365.4-1719s21c1
Sequence:CCGGAGTAGTGCCATGGGCAGAAAGCTCGAGCTTTCTGCCCATGGCACTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002365.4-2062s21c1
Sequence:CCGGTAGTGATCTGTTGCAAGATAACTCGAGTTATCTTGCAACAGATCACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002365
MAGEB3 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-1064s1c1
Sequence:CCGGCCCTCTAATCATGAAGACAAACTCGAGTTTGTCTTCATGATTAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-1485s1c1
Sequence:CCGGCAAGATTTGGTGAAGCTTAAACTCGAGTTTAAGCTTCACCAAATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-949s1c1
Sequence:CCGGCCACTACATCTGTAGATGTTTCTCGAGAAACATCTACAGATGTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002365.3-1988s1c1
Sequence:CCGGCTGGTCACATTTGTTGTTTAACTCGAGTTAAACAACAAATGTGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002365.3-1219s1c1
Sequence:CCGGAGGTGGTATTTGGTGTTGATTCTCGAGAATCAACACCAAATACCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002365.4-1719s21c1
Sequence:CCGGAGTAGTGCCATGGGCAGAAAGCTCGAGCTTTCTGCCCATGGCACTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002365.4-2062s21c1
Sequence:CCGGTAGTGATCTGTTGCAAGATAACTCGAGTTATCTTGCAACAGATCACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008545
MAGEB3 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1076s1c1
Sequence:CCGGGCTCTGGTATAGGTGGTAGAACTCGAGTTCTACCACCTATACCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1680s1c1
Sequence:CCGGCCATGCTGAAACAACCAAGATCTCGAGATCTTGGTTGTTTCAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008545.2-1945s1c1
Sequence:CCGGGCATCCATTCTTGGCCTGTTACTCGAGTAACAGGCCAAGAATGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1158s1c1
Sequence:CCGGGCACACACTGAAAGATCCTATCTCGAGATAGGATCTTTCAGTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1318s1c1
Sequence:CCGGGCACGCCTAGAATTGGTCTTTCTCGAGAAAGACCAATTCTAGGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008545
MAGEB3 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1076s1c1
Sequence:CCGGGCTCTGGTATAGGTGGTAGAACTCGAGTTCTACCACCTATACCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1680s1c1
Sequence:CCGGCCATGCTGAAACAACCAAGATCTCGAGATCTTGGTTGTTTCAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008545.2-1945s1c1
Sequence:CCGGGCATCCATTCTTGGCCTGTTACTCGAGTAACAGGCCAAGAATGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1158s1c1
Sequence:CCGGGCACACACTGAAAGATCCTATCTCGAGATAGGATCTTTCAGTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1318s1c1
Sequence:CCGGGCACGCCTAGAATTGGTCTTTCTCGAGAAAGACCAATTCTAGGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008545
MAGEB3 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1076s1c1
Sequence:CCGGGCTCTGGTATAGGTGGTAGAACTCGAGTTCTACCACCTATACCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1680s1c1
Sequence:CCGGCCATGCTGAAACAACCAAGATCTCGAGATCTTGGTTGTTTCAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008545.2-1945s1c1
Sequence:CCGGGCATCCATTCTTGGCCTGTTACTCGAGTAACAGGCCAAGAATGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1158s1c1
Sequence:CCGGGCACACACTGAAAGATCCTATCTCGAGATAGGATCTTTCAGTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008545.2-1318s1c1
Sequence:CCGGGCACGCCTAGAATTGGTCTTTCTCGAGAAAGACCAATTCTAGGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)