EMAIL THIS PAGE TO A FRIEND

MAGEB4

melanoma antigen family B, 4

63 Gene Product Result for
Synonyms: CT3.6
UniProtKB ID: O15481, B2R9G0, Q6FHH4, Q8IZ00
Gene ID:
Human(4115) Summary: This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEB genes are clustered on chromosome Xp22-p21. This gene sequence ends in the first intron of MAGEB1, another family member. This gene is expressed in testis. [provided by RefSeq, Jul 2008]
Mouse(434903) melanoma antigen, family B, 4
Rat(317271) melanoma antigen family B, 4
cow(767989) melanoma antigen family B, 4
dog(491802) melanoma antigen family B, 4
cow(510437) melanoma antigen family B, 4-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002367 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002367 Rosetta Predictions human pricing
XM_228597 Rosetta Predictions rat pricing
XR_008120 Rosetta Predictions rat pricing
NM_001033492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040577 predicted 674
2 SASI_Hs01_00040578 predicted 974
3 SASI_Hs01_00040579 predicted 475
4 SASI_Hs01_00040580 predicted 299
5 SASI_Hs01_00040582 predicted 384
6 SASI_Hs01_00040583 predicted 405
7 SASI_Hs01_00040584 predicted 1137
8 SASI_Hs01_00040585 predicted 777
9 SASI_Hs01_00040586 predicted 1180
10 SASI_Hs02_00333704 predicted 520
11 SASI_Hs01_00040581 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193637 predicted 274
2 SASI_Rn01_00193638 predicted 336
3 SASI_Rn01_00193639 predicted 629
4 SASI_Rn01_00193640 predicted 201
5 SASI_Rn01_00193641 predicted 676
6 SASI_Rn01_00193642 predicted 293
7 SASI_Rn01_00193643 predicted 282
8 SASI_Rn01_00193644 predicted 542
9 SASI_Rn01_00193645 predicted 368
10 SASI_Rn01_00193646 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136264 predicted 414
2 SASI_Rn01_00136265 predicted 476
3 SASI_Rn01_00136267 predicted 347
4 SASI_Rn02_00416261 predicted 592
5 SASI_Rn01_00136269 predicted 437
6 SASI_Rn01_00136270 predicted 429
7 SASI_Rn01_00136272 predicted 520
8 SASI_Rn02_00416262 predicted 454
9 SASI_Rn02_00416263 predicted 430
10 SASI_Rn02_00416264 predicted 457
11 SASI_Rn01_00136266 predicted 777
12 SASI_Rn01_00136268 predicted 824
13 SASI_Rn01_00136271 predicted 685
14 SASI_Rn01_00136273 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174880 predicted 570
2 SASI_Mm01_00174881 predicted 1468
3 SASI_Mm01_00174883 predicted 544
4 SASI_Mm02_00288859 predicted 1662
5 SASI_Mm01_00174885 predicted 503
6 SASI_Mm02_00288860 predicted 628
7 SASI_Mm01_00174886 predicted 1233
8 SASI_Mm01_00174887 predicted 1260
9 SASI_Mm01_00174888 predicted 1485
10 SASI_Mm01_00174882 predicted 1416
11 SASI_Mm01_00174884 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002367
MAGEB4 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002367.3-807s21c1
Sequence:CCGGTACTGAGTGTGATCTTCTTAACTCGAGTTAAGAAGATCACACTCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002367.3-1511s21c1
Sequence:CCGGACGGCATGGGAGTAAGGTTATCTCGAGATAACCTTACTCCCATGCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002367.3-1300s21c1
Sequence:CCGGGCATGAATAACTCATTGATTTCTCGAGAAATCAATGAGTTATTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002367.2-320s1c1
Sequence:CCGGGATCTGATAAAGGCGACGAGACTCGAGTCTCGTCGCCTTTATCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002367.2-309s1c1
Sequence:CCGGGTCATGCACTGGATCTGATAACTCGAGTTATCAGATCCAGTGCATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002367.2-1620s1c1
Sequence:CCGGCCATTGTCTTCCCTCCATTAACTCGAGTTAATGGAGGGAAGACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002367.2-731s1c1
Sequence:CCGGGTGAAGAGGAAATCTGGGAATCTCGAGATTCCCAGATTTCCTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002367.2-1630s1c1
Sequence:CCGGCCCTCCATTAAGAGAAGACTTCTCGAGAAGTCTTCTCTTAATGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002367.2-1305s1c1
Sequence:CCGGGCTGTTTATCAGGTTGGTTTACTCGAGTAAACCAACCTGATAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002367
MAGEB4 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002367.3-807s21c1
Sequence:CCGGTACTGAGTGTGATCTTCTTAACTCGAGTTAAGAAGATCACACTCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002367.3-1511s21c1
Sequence:CCGGACGGCATGGGAGTAAGGTTATCTCGAGATAACCTTACTCCCATGCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002367.3-1300s21c1
Sequence:CCGGGCATGAATAACTCATTGATTTCTCGAGAAATCAATGAGTTATTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002367.2-320s1c1
Sequence:CCGGGATCTGATAAAGGCGACGAGACTCGAGTCTCGTCGCCTTTATCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002367.2-309s1c1
Sequence:CCGGGTCATGCACTGGATCTGATAACTCGAGTTATCAGATCCAGTGCATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002367.2-1620s1c1
Sequence:CCGGCCATTGTCTTCCCTCCATTAACTCGAGTTAATGGAGGGAAGACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002367.2-731s1c1
Sequence:CCGGGTGAAGAGGAAATCTGGGAATCTCGAGATTCCCAGATTTCCTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002367.2-1630s1c1
Sequence:CCGGCCCTCCATTAAGAGAAGACTTCTCGAGAAGTCTTCTCTTAATGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002367.2-1305s1c1
Sequence:CCGGGCTGTTTATCAGGTTGGTTTACTCGAGTAAACCAACCTGATAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002367
MAGEB4 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002367.3-807s21c1
Sequence:CCGGTACTGAGTGTGATCTTCTTAACTCGAGTTAAGAAGATCACACTCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002367.3-1511s21c1
Sequence:CCGGACGGCATGGGAGTAAGGTTATCTCGAGATAACCTTACTCCCATGCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002367.3-1300s21c1
Sequence:CCGGGCATGAATAACTCATTGATTTCTCGAGAAATCAATGAGTTATTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002367.2-320s1c1
Sequence:CCGGGATCTGATAAAGGCGACGAGACTCGAGTCTCGTCGCCTTTATCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002367.2-309s1c1
Sequence:CCGGGTCATGCACTGGATCTGATAACTCGAGTTATCAGATCCAGTGCATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002367.2-1620s1c1
Sequence:CCGGCCATTGTCTTCCCTCCATTAACTCGAGTTAATGGAGGGAAGACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002367.2-731s1c1
Sequence:CCGGGTGAAGAGGAAATCTGGGAATCTCGAGATTCCCAGATTTCCTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002367.2-1630s1c1
Sequence:CCGGCCCTCCATTAAGAGAAGACTTCTCGAGAAGTCTTCTCTTAATGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002367.2-1305s1c1
Sequence:CCGGGCTGTTTATCAGGTTGGTTTACTCGAGTAAACCAACCTGATAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033492
MAGEB4 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000254518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033492.2-467s21c1
Sequence:CCGGGCCTGCAGAAGATCTCGTAAACTCGAGTTTACGAGATCTTCTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033492.2-1136s21c1
Sequence:CCGGCAGGCCTTCCCAACCCATTATCTCGAGATAATGGGTTGGGAAGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033492.2-2091s21c1
Sequence:CCGGTCAGGACTCACAGGTATAAATCTCGAGATTTATACCTGTGAGTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033492.2-785s21c1
Sequence:CCGGTTAGATCCCAGTGTCGGTAATCTCGAGATTACCGACACTGGGATCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033492
MAGEB4 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000254518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033492.2-467s21c1
Sequence:CCGGGCCTGCAGAAGATCTCGTAAACTCGAGTTTACGAGATCTTCTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033492.2-1136s21c1
Sequence:CCGGCAGGCCTTCCCAACCCATTATCTCGAGATAATGGGTTGGGAAGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033492.2-2091s21c1
Sequence:CCGGTCAGGACTCACAGGTATAAATCTCGAGATTTATACCTGTGAGTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033492.2-785s21c1
Sequence:CCGGTTAGATCCCAGTGTCGGTAATCTCGAGATTACCGACACTGGGATCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033492
MAGEB4 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000254518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033492.2-467s21c1
Sequence:CCGGGCCTGCAGAAGATCTCGTAAACTCGAGTTTACGAGATCTTCTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033492.2-1136s21c1
Sequence:CCGGCAGGCCTTCCCAACCCATTATCTCGAGATAATGGGTTGGGAAGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033492.2-2091s21c1
Sequence:CCGGTCAGGACTCACAGGTATAAATCTCGAGATTTATACCTGTGAGTCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033492.2-785s21c1
Sequence:CCGGTTAGATCCCAGTGTCGGTAATCTCGAGATTACCGACACTGGGATCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)