EMAIL THIS PAGE TO A FRIEND

MAGEB5

melanoma antigen family B, 5

65 Gene Product Result for
Synonyms: CT3.3 MAGE-B5
UniProtKB ID: Q9BZ81
Gene ID:
Mouse(74271) melanoma antigen, family B, 5
cow(782551) melanoma antigen family B, 5
dog(480870) melanoma antigen family B, 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715155 Rosetta Predictions human pricing
XM_293407 Rosetta Predictions human pricing
XM_942614 Rosetta Predictions human pricing
XM_284719 Rosetta Predictions mouse pricing
XM_908032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401820 predicted 739
2 SASI_Hs02_00401821 predicted 376
3 SASI_Hs02_00401822 predicted 732
4 SASI_Hs02_00401823 predicted 363
5 SASI_Hs02_00401824 predicted 538
6 SASI_Hs02_00401825 predicted 466
7 SASI_Hs02_00401826 predicted 628
8 SASI_Hs02_00401827 predicted 258
9 SASI_Hs02_00401828 predicted 850
10 SASI_Hs02_00401829 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_293407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479156 predicted 850
2 SASI_Hs02_00479157 predicted 929
3 SASI_Hs02_00479158 predicted 929
4 SASI_Hs02_00479159 predicted 883
5 SASI_Hs01_00286639 predicted 852
6 SASI_Hs02_00479160 predicted 891
7 SASI_Hs02_00479161 predicted 917
8 SASI_Hs02_00479162 predicted 858
9 SASI_Hs02_00479163 predicted 922
10 SASI_Hs02_00479164 predicted 926
11 SASI_Hs01_00286632 predicted 352
12 SASI_Hs01_00286633 predicted 702
13 SASI_Hs01_00286634 predicted 339
14 SASI_Hs01_00286635 predicted 515
15 SASI_Hs01_00286636 predicted 436
16 SASI_Hs01_00286637 predicted 599
17 SASI_Hs01_00286638 predicted 821
18 SASI_Hs01_00286640 predicted 340
19 SASI_Hs01_00286641 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_942614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485558 predicted 740
2 SASI_Hs02_00485559 predicted 378
3 SASI_Hs02_00485560 predicted 733
4 SASI_Hs02_00485561 predicted 368
5 SASI_Hs02_00485562 predicted 545
6 SASI_Hs02_00485563 predicted 474
7 SASI_Hs02_00485564 predicted 634
8 SASI_Hs02_00485565 predicted 264
9 SASI_Hs02_00485566 predicted 856
10 SASI_Hs02_00485567 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425672 predicted 464
2 SASI_Mm01_00215284 predicted 662
3 SASI_Mm01_00215285 predicted 537
4 SASI_Mm01_00215286 predicted 578
5 SASI_Mm01_00215287 predicted 846
6 SASI_Mm01_00215288 predicted 918
7 SASI_Mm01_00215289 predicted 961
8 SASI_Mm01_00215290 predicted 1046
9 SASI_Mm01_00215291 predicted 604
10 SASI_Mm01_00215292 predicted 1047
11 SASI_Mm01_00215293 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433709 predicted 456
2 SASI_Mm02_00433710 predicted 663
3 SASI_Mm02_00433711 predicted 540
4 SASI_Mm02_00433712 predicted 579
5 SASI_Mm02_00433713 predicted 841
6 SASI_Mm02_00433714 predicted 924
7 SASI_Mm02_00433715 predicted 968
8 SASI_Mm02_00433716 predicted 1050
9 SASI_Mm02_00433717 predicted 607
10 SASI_Mm02_00433718 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028847
MAGEB5 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-502s21c1
Sequence:CCGGCAGTATGTACTCTACAAATTTCTCGAGAAATTTGTAGAGTACATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-658s21c1
Sequence:CCGGGACTCAACTAATCACGTTTATCTCGAGATAAACGTGATTAGTTGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-568s21c1
Sequence:CCGGGAACCAAAGTACCGGTATAATCTCGAGATTATACCGGTACTTTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-885s21c1
Sequence:CCGGCATCACTCAAGATTTCGTAAACTCGAGTTTACGAAATCTTGAGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-758s21c1
Sequence:CCGGTGACTATCCTGGCTATGATTTCTCGAGAAATCATAGCCAGGATAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-385s21c1
Sequence:CCGGGAATTTGATGATGGTACTTACCTCGAGGTAAGTACCATCATCAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-1006s21c1
Sequence:CCGGGTCCTAGAATTTATGGCTAAACTCGAGTTTAGCCATAAATTCTAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028847
MAGEB5 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-502s21c1
Sequence:CCGGCAGTATGTACTCTACAAATTTCTCGAGAAATTTGTAGAGTACATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-658s21c1
Sequence:CCGGGACTCAACTAATCACGTTTATCTCGAGATAAACGTGATTAGTTGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-568s21c1
Sequence:CCGGGAACCAAAGTACCGGTATAATCTCGAGATTATACCGGTACTTTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-885s21c1
Sequence:CCGGCATCACTCAAGATTTCGTAAACTCGAGTTTACGAAATCTTGAGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-758s21c1
Sequence:CCGGTGACTATCCTGGCTATGATTTCTCGAGAAATCATAGCCAGGATAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-385s21c1
Sequence:CCGGGAATTTGATGATGGTACTTACCTCGAGGTAAGTACCATCATCAAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-1006s21c1
Sequence:CCGGGTCCTAGAATTTATGGCTAAACTCGAGTTTAGCCATAAATTCTAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028847
MAGEB5 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-502s21c1
Sequence:CCGGCAGTATGTACTCTACAAATTTCTCGAGAAATTTGTAGAGTACATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-658s21c1
Sequence:CCGGGACTCAACTAATCACGTTTATCTCGAGATAAACGTGATTAGTTGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-568s21c1
Sequence:CCGGGAACCAAAGTACCGGTATAATCTCGAGATTATACCGGTACTTTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-885s21c1
Sequence:CCGGCATCACTCAAGATTTCGTAAACTCGAGTTTACGAAATCTTGAGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-758s21c1
Sequence:CCGGTGACTATCCTGGCTATGATTTCTCGAGAAATCATAGCCAGGATAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-385s21c1
Sequence:CCGGGAATTTGATGATGGTACTTACCTCGAGGTAAGTACCATCATCAAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028847.1-1006s21c1
Sequence:CCGGGTCCTAGAATTTATGGCTAAACTCGAGTTTAGCCATAAATTCTAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)