EMAIL THIS PAGE TO A FRIEND

MAGEB6

melanoma antigen family B, 6

42 Gene Product Result for
Synonyms: CT3.4 MAGE-B6 MAGEB6A
UniProtKB ID: Q8N7X4, Q6GS19, Q9H219
Gene ID:
Human(158809) Summary: This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. This gene is expressed in testis, and in a significant fraction of tumors of various histological types. The MAGEB genes are clustered on chromosome Xp22-p21. [provided by RefSeq, Jul 2008]
Rat(302441) melanoma antigen family B, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173523 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109881 MISSION® esiRNA esiRNA human MAGEB6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173523 Rosetta Predictions human pricing
XM_001063539 Rosetta Predictions rat pricing
XM_228605 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208860 predicted 975
2 SASI_Hs01_00208861 predicted 1349
3 SASI_Hs01_00208862 predicted 1312
4 SASI_Hs01_00208864 predicted 1286
5 SASI_Hs01_00208865 predicted 1140
6 SASI_Hs01_00208866 predicted 1429
7 SASI_Hs01_00208867 predicted 677
8 SASI_Hs02_00368305 predicted 963
9 SASI_Hs02_00368306 predicted 1129
10 SASI_Hs01_00208868 predicted 1159
11 SASI_Hs01_00208863 predicted 1306
12 SASI_Hs01_00208869 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307502 predicted 931
2 SASI_Rn02_00307503 predicted 535
3 SASI_Rn02_00307504 predicted 457
4 SASI_Rn02_00307505 predicted 694
5 SASI_Rn02_00307506 predicted 570
6 SASI_Rn02_00307507 predicted 495
7 SASI_Rn02_00307508 predicted 738
8 SASI_Rn02_00307509 predicted 706
9 SASI_Rn02_00307510 predicted 695
10 SASI_Rn02_00307511 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385297 predicted 703
2 SASI_Rn02_00385298 predicted 305
3 SASI_Rn02_00385299 predicted 226
4 SASI_Rn02_00385300 predicted 461
5 SASI_Rn02_00385301 predicted 341
6 SASI_Rn02_00385302 predicted 267
7 SASI_Rn02_00385303 predicted 345
8 SASI_Rn02_00385304 predicted 510
9 SASI_Rn02_00385305 predicted 479
10 SASI_Rn02_00385306 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173523
MAGEB6 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1312s1c1
Sequence:CCGGCACATCTGTATGAAGACGCTTCTCGAGAAGCGTCTTCATACAGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1160s1c1
Sequence:CCGGGCAAGATAAGTACGTGGTTTACTCGAGTAAACCACGTACTTATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1134s1c1
Sequence:CCGGCGGAAGATCATTACTGAAGATCTCGAGATCTTCAGTAATGATCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173523.2-1688s1c1
Sequence:CCGGCCAATCTGAAAGTTACGGTTTCTCGAGAAACCGTAACTTTCAGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-873s1c1
Sequence:CCGGCAACATTTGGTGGTGGCCTTTCTCGAGAAAGGCCACCACCAAATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-714s1c1
Sequence:CCGGCGCTTAAGCAAAGATGCTGTACTCGAGTACAGCATCTTTGCTTAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1158s1c1
Sequence:CCGGGTGCAAGATAAGTACGTGGTTCTCGAGAACCACGTACTTATCTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-688s1c1
Sequence:CCGGCCTCACAGAAAGCCATCATTTCTCGAGAAATGATGGCTTTCTGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1351s1c1
Sequence:CCGGGAGCATTGAGACTGAGAGCTTCTCGAGAAGCTCTCAGTCTCAATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1301s1c1
Sequence:CCGGCGGTTTATACCCACATCTGTACTCGAGTACAGATGTGGGTATAAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173523
MAGEB6 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1312s1c1
Sequence:CCGGCACATCTGTATGAAGACGCTTCTCGAGAAGCGTCTTCATACAGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1160s1c1
Sequence:CCGGGCAAGATAAGTACGTGGTTTACTCGAGTAAACCACGTACTTATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1134s1c1
Sequence:CCGGCGGAAGATCATTACTGAAGATCTCGAGATCTTCAGTAATGATCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173523.2-1688s1c1
Sequence:CCGGCCAATCTGAAAGTTACGGTTTCTCGAGAAACCGTAACTTTCAGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-873s1c1
Sequence:CCGGCAACATTTGGTGGTGGCCTTTCTCGAGAAAGGCCACCACCAAATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-714s1c1
Sequence:CCGGCGCTTAAGCAAAGATGCTGTACTCGAGTACAGCATCTTTGCTTAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1158s1c1
Sequence:CCGGGTGCAAGATAAGTACGTGGTTCTCGAGAACCACGTACTTATCTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-688s1c1
Sequence:CCGGCCTCACAGAAAGCCATCATTTCTCGAGAAATGATGGCTTTCTGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1351s1c1
Sequence:CCGGGAGCATTGAGACTGAGAGCTTCTCGAGAAGCTCTCAGTCTCAATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1301s1c1
Sequence:CCGGCGGTTTATACCCACATCTGTACTCGAGTACAGATGTGGGTATAAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173523
MAGEB6 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1312s1c1
Sequence:CCGGCACATCTGTATGAAGACGCTTCTCGAGAAGCGTCTTCATACAGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1160s1c1
Sequence:CCGGGCAAGATAAGTACGTGGTTTACTCGAGTAAACCACGTACTTATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1134s1c1
Sequence:CCGGCGGAAGATCATTACTGAAGATCTCGAGATCTTCAGTAATGATCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173523.2-1688s1c1
Sequence:CCGGCCAATCTGAAAGTTACGGTTTCTCGAGAAACCGTAACTTTCAGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-873s1c1
Sequence:CCGGCAACATTTGGTGGTGGCCTTTCTCGAGAAAGGCCACCACCAAATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-714s1c1
Sequence:CCGGCGCTTAAGCAAAGATGCTGTACTCGAGTACAGCATCTTTGCTTAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1158s1c1
Sequence:CCGGGTGCAAGATAAGTACGTGGTTCTCGAGAACCACGTACTTATCTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-688s1c1
Sequence:CCGGCCTCACAGAAAGCCATCATTTCTCGAGAAATGATGGCTTTCTGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1351s1c1
Sequence:CCGGGAGCATTGAGACTGAGAGCTTCTCGAGAAGCTCTCAGTCTCAATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173523.2-1301s1c1
Sequence:CCGGCGGTTTATACCCACATCTGTACTCGAGTACAGATGTGGGTATAAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)