EMAIL THIS PAGE TO A FRIEND

MAGEB6P1

melanoma antigen family B, 6 pseudogene 1

30 Gene Product Result for
Synonyms: MAGEB6B
Species: Human MAGEB6P1(392433)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_373340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_373340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_373340 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715138 Rosetta Predictions human pricing
XM_373340 Rosetta Predictions human pricing
XM_942612 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401724 predicted 748
2 SASI_Hs02_00401725 predicted 741
3 SASI_Hs02_00401726 predicted 309
4 SASI_Hs02_00401727 predicted 736
5 SASI_Hs02_00401728 predicted 268
6 SASI_Hs02_00401729 predicted 532
7 SASI_Hs02_00401730 predicted 555
8 SASI_Hs02_00401731 predicted 519
9 SASI_Hs02_00401732 predicted 361
10 SASI_Hs02_00401733 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_373340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479497 predicted 729
2 SASI_Hs02_00479498 predicted 733
3 SASI_Hs02_00479499 predicted 788
4 SASI_Hs02_00479500 predicted 298
5 SASI_Hs02_00479501 predicted 719
6 SASI_Hs02_00479502 predicted 244
7 SASI_Hs02_00479503 predicted 522
8 SASI_Hs02_00479504 predicted 542
9 SASI_Hs02_00479505 predicted 503
10 SASI_Hs02_00479506 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_942612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485548 predicted 737
2 SASI_Hs02_00485549 predicted 729
3 SASI_Hs02_00485550 predicted 295
4 SASI_Hs02_00485551 predicted 721
5 SASI_Hs02_00485552 predicted 251
6 SASI_Hs02_00485553 predicted 521
7 SASI_Hs02_00485554 predicted 542
8 SASI_Hs02_00485555 predicted 510
9 SASI_Hs02_00485556 predicted 352
10 SASI_Hs02_00485557 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373340
MAGEB6P1 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family B, 6 pseudogene 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-619s1c1
Sequence:CCGGCAGAAGAAGTTTGAGAAGAAACTCGAGTTTCTTCTCAAACTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-723s1c1
Sequence:CCGGCGAACATTTGACGGTGTTCTTCTCGAGAAGAACACCGTCAAATGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-566s1c1
Sequence:CCGGCCACAGACGGAGATCCTATAACTCGAGTTATAGGATCTCCGTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-542s1c1
Sequence:CCGGCCAAGAGAGCTGCGTTCTTTACTCGAGTAAAGAACGCAGCTCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-678s1c1
Sequence:CCGGCAGACAGTACAAGCCATGCTTCTCGAGAAGCATGGCTTGTACTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-122s1c1
Sequence:CCGGCGTCATCCTCTTCTGCTGTTTCTCGAGAAACAGCAGAAGAGGATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-734s1c1
Sequence:CCGGCGGTGTTCTTTGGCGTTGAATCTCGAGATTCAACGCCAAAGAACACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-720s1c1
Sequence:CCGGCTCCGAACATTTGACGGTGTTCTCGAGAACACCGTCAAATGTTCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373340
MAGEB6P1 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family B, 6 pseudogene 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-619s1c1
Sequence:CCGGCAGAAGAAGTTTGAGAAGAAACTCGAGTTTCTTCTCAAACTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-723s1c1
Sequence:CCGGCGAACATTTGACGGTGTTCTTCTCGAGAAGAACACCGTCAAATGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-566s1c1
Sequence:CCGGCCACAGACGGAGATCCTATAACTCGAGTTATAGGATCTCCGTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-542s1c1
Sequence:CCGGCCAAGAGAGCTGCGTTCTTTACTCGAGTAAAGAACGCAGCTCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-678s1c1
Sequence:CCGGCAGACAGTACAAGCCATGCTTCTCGAGAAGCATGGCTTGTACTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-122s1c1
Sequence:CCGGCGTCATCCTCTTCTGCTGTTTCTCGAGAAACAGCAGAAGAGGATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-734s1c1
Sequence:CCGGCGGTGTTCTTTGGCGTTGAATCTCGAGATTCAACGCCAAAGAACACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-720s1c1
Sequence:CCGGCTCCGAACATTTGACGGTGTTCTCGAGAACACCGTCAAATGTTCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373340
MAGEB6P1 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family B, 6 pseudogene 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-619s1c1
Sequence:CCGGCAGAAGAAGTTTGAGAAGAAACTCGAGTTTCTTCTCAAACTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-723s1c1
Sequence:CCGGCGAACATTTGACGGTGTTCTTCTCGAGAAGAACACCGTCAAATGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-566s1c1
Sequence:CCGGCCACAGACGGAGATCCTATAACTCGAGTTATAGGATCTCCGTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-542s1c1
Sequence:CCGGCCAAGAGAGCTGCGTTCTTTACTCGAGTAAAGAACGCAGCTCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-678s1c1
Sequence:CCGGCAGACAGTACAAGCCATGCTTCTCGAGAAGCATGGCTTGTACTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-122s1c1
Sequence:CCGGCGTCATCCTCTTCTGCTGTTTCTCGAGAAACAGCAGAAGAGGATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-734s1c1
Sequence:CCGGCGGTGTTCTTTGGCGTTGAATCTCGAGATTCAACGCCAAAGAACACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373340.1-720s1c1
Sequence:CCGGCTCCGAACATTTGACGGTGTTCTCGAGAACACCGTCAAATGTTCGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)