EMAIL THIS PAGE TO A FRIEND

MAGEC2

melanoma antigen family C, 2

28 Gene Product Result for
Synonyms: CT10 HCA587 MAGEE1
Species: Human MAGEC2(51438)
UniProtKB ID: Q9UBF1, Q5JZ00, Q96D45, Q9P1M6, Q9P1M7
Gene ID:
Human(51438) Summary: This gene is a member of the MAGEC gene family. It is not expressed in normal tissues, except for testis, and is expressed in tumors of various histological types. This gene and the other MAGEC genes are clustered on chromosome Xq26-q27. [provided by RefSeq, Oct 2009]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016249 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126651 MISSION® esiRNA esiRNA human MAGEC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016249 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349130 predicted 952
2 SASI_Hs01_00051629 predicted 1022
3 SASI_Hs01_00051630 predicted 1502
4 SASI_Hs01_00051631 predicted 1312
5 SASI_Hs01_00051632 predicted 851
6 SASI_Hs01_00051633 predicted 476
7 SASI_Hs01_00051634 predicted 1312
8 SASI_Hs01_00051635 predicted 1415
9 SASI_Hs01_00051637 predicted 750
10 SASI_Hs02_00349131 predicted 976
11 SASI_Hs01_00051628 predicted 1494
12 SASI_Hs01_00051636 predicted 1467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016249
MAGEC2 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family C, 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1699s21c1
Sequence:CCGGTTTATCTGGTTTAAGAGTAACCTCGAGGTTACTCTTAAACCAGATAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1648s21c1
Sequence:CCGGAGTTAGCTTCAGAGTGTTAATCTCGAGATTAACACTCTGAAGCTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1779s21c1
Sequence:CCGGAGGGTAGTGTGGTATTGTAATCTCGAGATTACAATACCACACTACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1495s21c1
Sequence:CCGGGTGTTTGAACAGGGCAGTTTACTCGAGTAAACTGCCCTGTTCAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1675s21c1
Sequence:CCGGATATTAGTCGCACATGTATTGCTCGAGCAATACATGTGCGACTAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1744s21c1
Sequence:CCGGGGAAATACCTTCTCCCTTATTCTCGAGAATAAGGGAGAAGGTATTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016249.3-1466s21c1
Sequence:CCGGAGTGAAGTCTAGGATAGTTTCCTCGAGGAAACTATCCTAGACTTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016249.2-1838s1c1
Sequence:CCGGGCAGTTAAATAGTGGAACAAACTCGAGTTTGTTCCACTATTTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016249.2-952s1c1
Sequence:CCGGCCTGACCACTTCTGTGTGTTTCTCGAGAAACACACAGAAGTGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016249.2-1384s1c1
Sequence:CCGGGCCACAATTGATACCGCAGATCTCGAGATCTGCGGTATCAATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016249.2-471s1c1
Sequence:CCGGCGCCTCTTCCACTTTGTACTTCTCGAGAAGTACAAAGTGGAAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016249
MAGEC2 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family C, 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1699s21c1
Sequence:CCGGTTTATCTGGTTTAAGAGTAACCTCGAGGTTACTCTTAAACCAGATAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1648s21c1
Sequence:CCGGAGTTAGCTTCAGAGTGTTAATCTCGAGATTAACACTCTGAAGCTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1779s21c1
Sequence:CCGGAGGGTAGTGTGGTATTGTAATCTCGAGATTACAATACCACACTACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1495s21c1
Sequence:CCGGGTGTTTGAACAGGGCAGTTTACTCGAGTAAACTGCCCTGTTCAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1675s21c1
Sequence:CCGGATATTAGTCGCACATGTATTGCTCGAGCAATACATGTGCGACTAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1744s21c1
Sequence:CCGGGGAAATACCTTCTCCCTTATTCTCGAGAATAAGGGAGAAGGTATTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016249.3-1466s21c1
Sequence:CCGGAGTGAAGTCTAGGATAGTTTCCTCGAGGAAACTATCCTAGACTTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016249.2-1838s1c1
Sequence:CCGGGCAGTTAAATAGTGGAACAAACTCGAGTTTGTTCCACTATTTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016249.2-952s1c1
Sequence:CCGGCCTGACCACTTCTGTGTGTTTCTCGAGAAACACACAGAAGTGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016249.2-1384s1c1
Sequence:CCGGGCCACAATTGATACCGCAGATCTCGAGATCTGCGGTATCAATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016249.2-471s1c1
Sequence:CCGGCGCCTCTTCCACTTTGTACTTCTCGAGAAGTACAAAGTGGAAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016249
MAGEC2 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family C, 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1699s21c1
Sequence:CCGGTTTATCTGGTTTAAGAGTAACCTCGAGGTTACTCTTAAACCAGATAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1648s21c1
Sequence:CCGGAGTTAGCTTCAGAGTGTTAATCTCGAGATTAACACTCTGAAGCTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1779s21c1
Sequence:CCGGAGGGTAGTGTGGTATTGTAATCTCGAGATTACAATACCACACTACCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1495s21c1
Sequence:CCGGGTGTTTGAACAGGGCAGTTTACTCGAGTAAACTGCCCTGTTCAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1675s21c1
Sequence:CCGGATATTAGTCGCACATGTATTGCTCGAGCAATACATGTGCGACTAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016249.3-1744s21c1
Sequence:CCGGGGAAATACCTTCTCCCTTATTCTCGAGAATAAGGGAGAAGGTATTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016249.3-1466s21c1
Sequence:CCGGAGTGAAGTCTAGGATAGTTTCCTCGAGGAAACTATCCTAGACTTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016249.2-1838s1c1
Sequence:CCGGGCAGTTAAATAGTGGAACAAACTCGAGTTTGTTCCACTATTTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016249.2-952s1c1
Sequence:CCGGCCTGACCACTTCTGTGTGTTTCTCGAGAAACACACAGAAGTGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016249.2-1384s1c1
Sequence:CCGGGCCACAATTGATACCGCAGATCTCGAGATCTGCGGTATCAATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016249.2-471s1c1
Sequence:CCGGCGCCTCTTCCACTTTGTACTTCTCGAGAAGTACAAAGTGGAAGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)