EMAIL THIS PAGE TO A FRIEND

MAGED2

melanoma antigen family D, 2

85 Gene Product Result for
Synonyms: 11B6 BCG-1 BCG1 HCA10 MAGE-D2
Gene ID:
Human(10916) Summary: This gene is a member of the MAGED gene family. While the MAGEA and MAGEB genes are silent in normal tissues with the exception of testis and placenta, the MAGED genes are expressed ubiquitously. The MAGED genes are clustered on chromosome Xp11. This gene is located in Xp11.2, a hot spot for X-linked mental retardation (XLMR). Multiple alternatively spliced transcript variants have been found for this gene, however, the full length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Mouse(80884) melanoma antigen, family D, 2
Rat(113947) melanoma antigen, family D, 2
Domestic Rabbit(100342914) melanoma antigen family D, 2
cow(514372) melanoma antigen family D, 2
Horse(100060545) melanoma antigen family D, 2
dog(480934) melanoma antigen family D, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201222 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014599 Rosetta Predictions human pricing
NM_177433 Rosetta Predictions human pricing
NM_201222 Rosetta Predictions human pricing
NM_080479 Rosetta Predictions rat pricing
NM_030700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017974 predicted 942
2 SASI_Hs01_00017975 predicted 471
3 SASI_Hs02_00345881 predicted 470
4 SASI_Hs01_00017977 predicted 1077
5 SASI_Hs02_00345882 predicted 373
6 SASI_Hs01_00017980 predicted 350
7 SASI_Hs01_00017981 predicted 1304
8 SASI_Hs01_00017982 predicted 1179
9 SASI_Hs02_00345883 predicted 936
10 SASI_Hs01_00017983 predicted 992
11 SASI_Hs01_00017976 predicted 543
12 SASI_Hs01_00017978 predicted 403
13 SASI_Hs01_00017979 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232052 predicted 935
2 SASI_Hs01_00232053 predicted 468
3 SASI_Hs02_00369329 predicted 468
4 SASI_Hs01_00232055 predicted 1079
5 SASI_Hs02_00369330 predicted 362
6 SASI_Hs01_00232058 predicted 344
7 SASI_Hs01_00232059 predicted 1293
8 SASI_Hs01_00232060 predicted 1174
9 SASI_Hs02_00369331 predicted 934
10 SASI_Hs01_00232061 predicted 988
11 SASI_Hs01_00232054 predicted 547
12 SASI_Hs01_00232056 predicted 391
13 SASI_Hs01_00232057 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170749 predicted 1030
2 SASI_Hs01_00170750 predicted 565
3 SASI_Hs02_00372893 predicted 568
4 SASI_Hs01_00170752 predicted 1179
5 SASI_Hs02_00372894 predicted 461
6 SASI_Hs01_00170755 predicted 441
7 SASI_Hs01_00170756 predicted 1397
8 SASI_Hs01_00170757 predicted 1271
9 SASI_Hs02_00372895 predicted 1038
10 SASI_Hs01_00170758 predicted 1085
11 SASI_Hs01_00170751 predicted 644
12 SASI_Hs01_00170753 predicted 496
13 SASI_Hs01_00170754 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107091 predicted 915
2 SASI_Rn01_00107092 predicted 1303
3 SASI_Rn01_00107093 predicted 1045
4 SASI_Rn01_00107094 predicted 450
5 SASI_Rn01_00107095 predicted 1095
6 SASI_Rn01_00107096 predicted 449
7 SASI_Rn01_00107097 predicted 1428
8 SASI_Rn01_00107098 predicted 1094
9 SASI_Rn01_00107099 predicted 1474
10 SASI_Rn01_00107100 predicted 1621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178045 predicted 1061
2 SASI_Mm01_00178046 predicted 974
3 SASI_Mm01_00178047 predicted 1353
4 SASI_Mm01_00178048 predicted 1001
5 SASI_Mm01_00178049 predicted 1352
6 SASI_Mm01_00178051 predicted 988
7 SASI_Mm02_00336868 predicted 1316
8 SASI_Mm01_00178052 predicted 931
9 SASI_Mm01_00178053 predicted 1635
10 SASI_Mm01_00178054 predicted 1102
11 SASI_Mm01_00178050 predicted 1445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201222
VALIDATED
MAGED2 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family D, 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201222.1-1123s1c1
Sequence:CCGGCAAAGAATACACTGATGTGTACTCGAGTACACATCAGTGTATTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201222.1-920s1c1
Sequence:CCGGCTCTCCCTGAGATCACCTAAACTCGAGTTTAGGTGATCTCAGGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201222.1-709s1c1
Sequence:CCGGCAAAGCCAAGAAAGCCCGAAACTCGAGTTTCGGGCTTTCTTGGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-1180s21c1
Sequence:CCGGGAAGGTATTTGGGATTCAATTCTCGAGAATTGAATCCCAAATACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-1153s21c1
Sequence:CCGGCATTGAACGAGCAGGCTATTCCTCGAGGAATAGCCTGCTCGTTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-580s21c1
Sequence:CCGGGGCTGATACAAAGGTCAATACCTCGAGGTATTGACCTTTGTATCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201222.1-803s21c1
Sequence:CCGGAGGGTCTCAAAGGCCCTAATGCTCGAGCATTAGGGCCTTTGAGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-693s21c1
Sequence:CCGGATACTCGGCCCAAGGTCAAAGCTCGAGCTTTGACCTTGGGCCGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201222
VALIDATED
MAGED2 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family D, 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201222.1-1123s1c1
Sequence:CCGGCAAAGAATACACTGATGTGTACTCGAGTACACATCAGTGTATTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201222.1-920s1c1
Sequence:CCGGCTCTCCCTGAGATCACCTAAACTCGAGTTTAGGTGATCTCAGGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201222.1-709s1c1
Sequence:CCGGCAAAGCCAAGAAAGCCCGAAACTCGAGTTTCGGGCTTTCTTGGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-1180s21c1
Sequence:CCGGGAAGGTATTTGGGATTCAATTCTCGAGAATTGAATCCCAAATACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-1153s21c1
Sequence:CCGGCATTGAACGAGCAGGCTATTCCTCGAGGAATAGCCTGCTCGTTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-580s21c1
Sequence:CCGGGGCTGATACAAAGGTCAATACCTCGAGGTATTGACCTTTGTATCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201222.1-803s21c1
Sequence:CCGGAGGGTCTCAAAGGCCCTAATGCTCGAGCATTAGGGCCTTTGAGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-693s21c1
Sequence:CCGGATACTCGGCCCAAGGTCAAAGCTCGAGCTTTGACCTTGGGCCGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201222
VALIDATED
MAGED2 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family D, 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201222.1-1123s1c1
Sequence:CCGGCAAAGAATACACTGATGTGTACTCGAGTACACATCAGTGTATTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201222.1-920s1c1
Sequence:CCGGCTCTCCCTGAGATCACCTAAACTCGAGTTTAGGTGATCTCAGGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201222.1-709s1c1
Sequence:CCGGCAAAGCCAAGAAAGCCCGAAACTCGAGTTTCGGGCTTTCTTGGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-1180s21c1
Sequence:CCGGGAAGGTATTTGGGATTCAATTCTCGAGAATTGAATCCCAAATACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-1153s21c1
Sequence:CCGGCATTGAACGAGCAGGCTATTCCTCGAGGAATAGCCTGCTCGTTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-580s21c1
Sequence:CCGGGGCTGATACAAAGGTCAATACCTCGAGGTATTGACCTTTGTATCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201222.1-803s21c1
Sequence:CCGGAGGGTCTCAAAGGCCCTAATGCTCGAGCATTAGGGCCTTTGAGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_201222.1-693s21c1
Sequence:CCGGATACTCGGCCCAAGGTCAAAGCTCGAGCTTTGACCTTGGGCCGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030700
MAGED2 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family D, 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000095029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030700.1-1937s1c1
Sequence:CCGGTGCTAATAATCACAGCGTCTTCTCGAGAAGACGCTGTGATTATTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030700.1-1135s1c1
Sequence:CCGGGCCAACTGATGCAGGCATATTCTCGAGAATATGCCTGCATCAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030700.1-1134s1c1
Sequence:CCGGAGCCAACTGATGCAGGCATATCTCGAGATATGCCTGCATCAGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030700.1-1361s1c1
Sequence:CCGGGCCAGAGTACCCAATAGCAATCTCGAGATTGCTATTGGGTACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030700
MAGED2 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family D, 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000095029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030700.1-1937s1c1
Sequence:CCGGTGCTAATAATCACAGCGTCTTCTCGAGAAGACGCTGTGATTATTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030700.1-1135s1c1
Sequence:CCGGGCCAACTGATGCAGGCATATTCTCGAGAATATGCCTGCATCAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030700.1-1134s1c1
Sequence:CCGGAGCCAACTGATGCAGGCATATCTCGAGATATGCCTGCATCAGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030700.1-1361s1c1
Sequence:CCGGGCCAGAGTACCCAATAGCAATCTCGAGATTGCTATTGGGTACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030700
MAGED2 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family D, 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000095029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030700.1-1937s1c1
Sequence:CCGGTGCTAATAATCACAGCGTCTTCTCGAGAAGACGCTGTGATTATTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030700.1-1135s1c1
Sequence:CCGGGCCAACTGATGCAGGCATATTCTCGAGAATATGCCTGCATCAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030700.1-1134s1c1
Sequence:CCGGAGCCAACTGATGCAGGCATATCTCGAGATATGCCTGCATCAGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030700.1-1361s1c1
Sequence:CCGGGCCAGAGTACCCAATAGCAATCTCGAGATTGCTATTGGGTACTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)