EMAIL THIS PAGE TO A FRIEND

MAGED4

melanoma antigen family D, 4

28 Gene Product Result for
Synonyms: MAGE-E1 MAGE1 MAGEE1
Gene ID:
Horse(100059523) melanoma antigen family D, 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098800 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098800 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319899 predicted 313
2 SASI_Hs02_00319900 predicted 1869
3 SASI_Hs02_00319901 predicted 659
4 SASI_Hs02_00319902 predicted 745
5 SASI_Hs02_00319903 predicted 1309
6 SASI_Hs02_00319904 predicted 1397
7 SASI_Hs02_00319905 predicted 1488
8 SASI_Hs02_00319906 predicted 1822
9 SASI_Hs02_00319907 predicted 1312
10 SASI_Hs02_00319908 predicted 1976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098800
MAGED4 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family D, 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098800.1-2292s21c1
Sequence:CCGGGACGAACTGCAGCGATCTTACCTCGAGGTAAGATCGCTGCAGTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-1858s21c1
Sequence:CCGGCCGGGAATGGAAGGCTCATTTCTCGAGAAATGAGCCTTCCATTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-1291s21c1
Sequence:CCGGTCTGCAGGAGAGGGCAAATAACTCGAGTTATTTGCCCTCTCCTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-243s21c1
Sequence:CCGGGTCCAGGCCTTCGCATCTTATCTCGAGATAAGATGCGAAGGCCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-199s21c1
Sequence:CCGGCACCAGCTTTGACATCCATATCTCGAGATATGGATGTCAAAGCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098800
MAGED4 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family D, 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098800.1-2292s21c1
Sequence:CCGGGACGAACTGCAGCGATCTTACCTCGAGGTAAGATCGCTGCAGTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-1858s21c1
Sequence:CCGGCCGGGAATGGAAGGCTCATTTCTCGAGAAATGAGCCTTCCATTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-1291s21c1
Sequence:CCGGTCTGCAGGAGAGGGCAAATAACTCGAGTTATTTGCCCTCTCCTGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-243s21c1
Sequence:CCGGGTCCAGGCCTTCGCATCTTATCTCGAGATAAGATGCGAAGGCCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-199s21c1
Sequence:CCGGCACCAGCTTTGACATCCATATCTCGAGATATGGATGTCAAAGCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098800
MAGED4 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family D, 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098800.1-2292s21c1
Sequence:CCGGGACGAACTGCAGCGATCTTACCTCGAGGTAAGATCGCTGCAGTTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-1858s21c1
Sequence:CCGGCCGGGAATGGAAGGCTCATTTCTCGAGAAATGAGCCTTCCATTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-1291s21c1
Sequence:CCGGTCTGCAGGAGAGGGCAAATAACTCGAGTTATTTGCCCTCTCCTGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-243s21c1
Sequence:CCGGGTCCAGGCCTTCGCATCTTATCTCGAGATAAGATGCGAAGGCCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098800.1-199s21c1
Sequence:CCGGCACCAGCTTTGACATCCATATCTCGAGATATGGATGTCAAAGCTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)