EMAIL THIS PAGE TO A FRIEND

MAGED4B

melanoma antigen family D, 4B

41 Gene Product Result for
Gene ID:
Human(81557) Summary: This gene is a member of the MAGED gene family. It is expressed only in brain and ovary, and some transcript variants of this gene are specifically expressed in glioma cells. This gene is clustered with other MAGED genes on chromosome Xp11. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
cow(100125231) melanoma antigen family D, 4B
Domestic Rabbit(100356150) melanoma antigen family D, 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177537 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113431 MISSION® esiRNA esiRNA human MAGED4B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030801 Rosetta Predictions human pricing
NM_177535 Rosetta Predictions human pricing
NM_177537 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146672 predicted 679
2 SASI_Hs01_00146673 predicted 428
3 SASI_Hs01_00146674 predicted 1304
4 SASI_Hs02_00358362 predicted 1990
5 SASI_Hs02_00358363 predicted 777
6 SASI_Hs01_00146675 predicted 787
7 SASI_Hs01_00146676 predicted 858
8 SASI_Hs01_00146677 predicted 1512
9 SASI_Hs01_00146678 predicted 1606
10 SASI_Hs01_00146679 predicted 1943
11 SASI_Hs01_00146680 predicted 1941
12 SASI_Hs01_00146681 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247055 predicted 652
2 SASI_Hs01_00247056 predicted 400
3 SASI_Hs01_00247057 predicted 1275
4 SASI_Hs02_00369378 predicted 1956
5 SASI_Hs02_00369379 predicted 752
6 SASI_Hs01_00247058 predicted 755
7 SASI_Hs01_00247059 predicted 828
8 SASI_Hs01_00247060 predicted 1484
9 SASI_Hs01_00247061 predicted 1569
10 SASI_Hs01_00247062 predicted 1910
11 SASI_Hs01_00247063 predicted 1914
12 SASI_Hs01_00247064 predicted 1406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111528 predicted 654
2 SASI_Hs01_00111529 predicted 405
3 SASI_Hs01_00111530 predicted 1276
4 SASI_Hs02_00369380 predicted 1951
5 SASI_Hs02_00369381 predicted 748
6 SASI_Hs01_00111531 predicted 754
7 SASI_Hs01_00111532 predicted 833
8 SASI_Hs01_00111533 predicted 1479
9 SASI_Hs01_00111534 predicted 1571
10 SASI_Hs01_00111535 predicted 1908
11 SASI_Hs01_00111536 predicted 1914
12 SASI_Hs01_00111537 predicted 1402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177537
MAGED4B MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family D, 4B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177537.1-289s21c1
Sequence:CCGGACCAGCTTTGACATCCATATCCTCGAGGATATGGATGTCAAAGCTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177537.1-2415s1c1
Sequence:CCGGGCGCCTCCTCTCAGATTCCTTCTCGAGAAGGAATCTGAGAGGAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-1416s1c1
Sequence:CCGGGATGATTAAGGACTACAAGAACTCGAGTTCTTGTAGTCCTTAATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-657s1c1
Sequence:CCGGCCAGATGTTAGTCACCAGTAACTCGAGTTACTGGTGACTAACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-837s1c1
Sequence:CCGGCCAGAATGATGTCTTCGATTTCTCGAGAAATCGAAGACATCATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-1844s1c1
Sequence:CCGGGCAACCCACCTGAGTATGAATCTCGAGATTCATACTCAGGTGGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177537
MAGED4B MISSION shRNA shRNA Plasmid DNA
melanoma antigen family D, 4B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177537.1-289s21c1
Sequence:CCGGACCAGCTTTGACATCCATATCCTCGAGGATATGGATGTCAAAGCTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177537.1-2415s1c1
Sequence:CCGGGCGCCTCCTCTCAGATTCCTTCTCGAGAAGGAATCTGAGAGGAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-1416s1c1
Sequence:CCGGGATGATTAAGGACTACAAGAACTCGAGTTCTTGTAGTCCTTAATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-657s1c1
Sequence:CCGGCCAGATGTTAGTCACCAGTAACTCGAGTTACTGGTGACTAACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-837s1c1
Sequence:CCGGCCAGAATGATGTCTTCGATTTCTCGAGAAATCGAAGACATCATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-1844s1c1
Sequence:CCGGGCAACCCACCTGAGTATGAATCTCGAGATTCATACTCAGGTGGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177537
MAGED4B MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family D, 4B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177537.1-289s21c1
Sequence:CCGGACCAGCTTTGACATCCATATCCTCGAGGATATGGATGTCAAAGCTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177537.1-2415s1c1
Sequence:CCGGGCGCCTCCTCTCAGATTCCTTCTCGAGAAGGAATCTGAGAGGAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-1416s1c1
Sequence:CCGGGATGATTAAGGACTACAAGAACTCGAGTTCTTGTAGTCCTTAATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-657s1c1
Sequence:CCGGCCAGATGTTAGTCACCAGTAACTCGAGTTACTGGTGACTAACATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-837s1c1
Sequence:CCGGCCAGAATGATGTCTTCGATTTCTCGAGAAATCGAAGACATCATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177537.1-1844s1c1
Sequence:CCGGGCAACCCACCTGAGTATGAATCTCGAGATTCATACTCAGGTGGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)