EMAIL THIS PAGE TO A FRIEND

MAGEE1

melanoma antigen family E, 1

48 Gene Product Result for
Synonyms: DAMAGE HCA1
UniProtKB ID: Q9HCI5, Q86TG0, Q8TD92, Q9H216
Gene ID:
Human(57692) Summary: This gene encodes an alpha-dystrobrevin-associated MAGE (melanoma-associated antigen) protein, which is a member of the MAGE family. The protein contains a nuclear localization signal in the N-terminus, 30 12-amino acid repeats beginning at nt 60 with the consensus sequence ASEGPSTSVLPT, and two MAGE domains in the C-terminus. It may play a signaling role in brain, muscle, and peripheral nerve. This gene is located on X chromosome in a region containing loci linked to mental retardation. [provided by RefSeq, Mar 2010]
Mouse(107528) melanoma antigen, family E, 1
Rat(317232) melanoma antigen, family E, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020932 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020932 Rosetta Predictions human pricing
NM_001079891 Rosetta Predictions rat pricing
NM_053201 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138424 predicted 3043
2 SASI_Hs01_00138425 predicted 1729
3 SASI_Hs01_00138426 predicted 2089
4 SASI_Hs01_00138427 predicted 2240
5 SASI_Hs01_00138428 predicted 2138
6 SASI_Hs01_00138429 predicted 2833
7 SASI_Hs01_00138430 predicted 1614
8 SASI_Hs01_00138431 predicted 2466
9 SASI_Hs01_00138432 predicted 2604
10 SASI_Hs01_00138433 predicted 2686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208219 predicted 1991
2 SASI_Rn02_00208220 predicted 1884
3 SASI_Rn02_00208221 predicted 1701
4 SASI_Rn02_00208222 predicted 1407
5 SASI_Rn02_00208223 predicted 1948
6 SASI_Rn02_00208224 predicted 2040
7 SASI_Rn02_00208225 predicted 2300
8 SASI_Rn02_00208226 predicted 867
9 SASI_Rn02_00208227 predicted 2774
10 SASI_Rn02_00208228 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039548 predicted 1845
2 SASI_Mm01_00039549 predicted 2706
3 SASI_Mm01_00039550 predicted 2563
4 SASI_Mm02_00337779 predicted 611
5 SASI_Mm01_00039551 predicted 2005
6 SASI_Mm01_00039553 predicted 1662
7 SASI_Mm01_00039554 predicted 2339
8 SASI_Mm01_00039555 predicted 2586
9 SASI_Mm02_00337780 predicted 760
10 SASI_Mm01_00039556 predicted 2761
11 SASI_Mm01_00039552 predicted 1851
12 SASI_Mm01_00039557 predicted 1539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020932
MAGEE1 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family E, 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020932.1-3233s1c1
Sequence:CCGGCTGGAAATGTTTCAACTGTTTCTCGAGAAACAGTTGAAACATTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-2887s1c1
Sequence:CCGGCCAGTGCAATATGAGTTTGTACTCGAGTACAAACTCATATTGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-2888s1c1
Sequence:CCGGCAGTGCAATATGAGTTTGTATCTCGAGATACAAACTCATATTGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-2922s1c1
Sequence:CCGGCCGTTTGGAAACCTCTAAGATCTCGAGATCTTAGAGGTTTCCAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-1617s1c1
Sequence:CCGGCATTAGTATTATGGGCCTCAACTCGAGTTGAGGCCCATAATACTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020932.2-3329s21c1
Sequence:CCGGATATTGTCTGATTGGGTAAATCTCGAGATTTACCCAATCAGACAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020932.2-1819s21c1
Sequence:CCGGAGTCTGAAATGCGGGAATATACTCGAGTATATTCCCGCATTTCAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020932
MAGEE1 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family E, 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020932.1-3233s1c1
Sequence:CCGGCTGGAAATGTTTCAACTGTTTCTCGAGAAACAGTTGAAACATTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-2887s1c1
Sequence:CCGGCCAGTGCAATATGAGTTTGTACTCGAGTACAAACTCATATTGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-2888s1c1
Sequence:CCGGCAGTGCAATATGAGTTTGTATCTCGAGATACAAACTCATATTGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-2922s1c1
Sequence:CCGGCCGTTTGGAAACCTCTAAGATCTCGAGATCTTAGAGGTTTCCAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-1617s1c1
Sequence:CCGGCATTAGTATTATGGGCCTCAACTCGAGTTGAGGCCCATAATACTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020932.2-3329s21c1
Sequence:CCGGATATTGTCTGATTGGGTAAATCTCGAGATTTACCCAATCAGACAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020932.2-1819s21c1
Sequence:CCGGAGTCTGAAATGCGGGAATATACTCGAGTATATTCCCGCATTTCAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020932
MAGEE1 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family E, 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115847    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020932.1-3233s1c1
Sequence:CCGGCTGGAAATGTTTCAACTGTTTCTCGAGAAACAGTTGAAACATTTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-2887s1c1
Sequence:CCGGCCAGTGCAATATGAGTTTGTACTCGAGTACAAACTCATATTGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-2888s1c1
Sequence:CCGGCAGTGCAATATGAGTTTGTATCTCGAGATACAAACTCATATTGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-2922s1c1
Sequence:CCGGCCGTTTGGAAACCTCTAAGATCTCGAGATCTTAGAGGTTTCCAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020932.1-1617s1c1
Sequence:CCGGCATTAGTATTATGGGCCTCAACTCGAGTTGAGGCCCATAATACTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020932.2-3329s21c1
Sequence:CCGGATATTGTCTGATTGGGTAAATCTCGAGATTTACCCAATCAGACAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020932.2-1819s21c1
Sequence:CCGGAGTCTGAAATGCGGGAATATACTCGAGTATATTCCCGCATTTCAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053201
MAGEE1 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family E, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-2255s1c1
Sequence:CCGGGCTAGATGCTTCTGGCTCAAACTCGAGTTTGAGCCAGAAGCATCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-1033s1c1
Sequence:CCGGCCATCATAATGGAGGGATGTACTCGAGTACATCCCTCCATTATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-2690s1c1
Sequence:CCGGCGTGATTACCTGTCGGTATTTCTCGAGAAATACCGACAGGTAATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-1577s1c1
Sequence:CCGGCGTAGCAGAATTGTTGCAGTTCTCGAGAACTGCAACAATTCTGCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053201.2-3248s1c1
Sequence:CCGGGCATTGTCTGAAAGAGAACATCTCGAGATGTTCTCTTTCAGACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053201
MAGEE1 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family E, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-2255s1c1
Sequence:CCGGGCTAGATGCTTCTGGCTCAAACTCGAGTTTGAGCCAGAAGCATCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-1033s1c1
Sequence:CCGGCCATCATAATGGAGGGATGTACTCGAGTACATCCCTCCATTATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-2690s1c1
Sequence:CCGGCGTGATTACCTGTCGGTATTTCTCGAGAAATACCGACAGGTAATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-1577s1c1
Sequence:CCGGCGTAGCAGAATTGTTGCAGTTCTCGAGAACTGCAACAATTCTGCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053201.2-3248s1c1
Sequence:CCGGGCATTGTCTGAAAGAGAACATCTCGAGATGTTCTCTTTCAGACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053201
MAGEE1 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family E, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-2255s1c1
Sequence:CCGGGCTAGATGCTTCTGGCTCAAACTCGAGTTTGAGCCAGAAGCATCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-1033s1c1
Sequence:CCGGCCATCATAATGGAGGGATGTACTCGAGTACATCCCTCCATTATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-2690s1c1
Sequence:CCGGCGTGATTACCTGTCGGTATTTCTCGAGAAATACCGACAGGTAATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053201.2-1577s1c1
Sequence:CCGGCGTAGCAGAATTGTTGCAGTTCTCGAGAACTGCAACAATTCTGCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053201.2-3248s1c1
Sequence:CCGGGCATTGTCTGAAAGAGAACATCTCGAGATGTTCTCTTTCAGACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)