EMAIL THIS PAGE TO A FRIEND

MAGEE2

melanoma antigen family E, 2

65 Gene Product Result for
Synonyms: HCA3
UniProtKB ID: Q8TD90, Q5JSI5
Gene ID:
Human(139599) Summary: This gene encodes a member of the E subfamily of MAGE (melanoma antigen-encoding gene) gene family. The gene is intronless and the encoded protein has two of the MAGE domains which are characteristic of MAGE family proteins. [provided by RefSeq, Sep 2011]
Mouse(272790) melanoma antigen, family E, 2
Rat(302392) melanoma antigen, family E, 2
cow(525318) melanoma antigen family E, 2
dog(480961) melanoma antigen family E, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138703 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137691 MISSION® esiRNA esiRNA human MAGEE2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138703 Rosetta Predictions human pricing
NM_001106941 Rosetta Predictions rat pricing
NM_053206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111704 predicted 1451
2 SASI_Hs01_00111705 predicted 775
3 SASI_Hs01_00111706 predicted 867
4 SASI_Hs01_00111707 predicted 633
5 SASI_Hs01_00111708 predicted 1793
6 SASI_Hs01_00111709 predicted 1117
7 SASI_Hs01_00111710 predicted 943
8 SASI_Hs02_00363803 predicted 529
9 SASI_Hs01_00111712 predicted 377
10 SASI_Hs01_00111713 predicted 1755
11 SASI_Hs01_00111711 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223916 predicted 1279
2 SASI_Rn02_00223917 predicted 609
3 SASI_Rn02_00223918 predicted 1530
4 SASI_Rn02_00223919 predicted 1150
5 SASI_Rn02_00223920 predicted 894
6 SASI_Rn02_00223921 predicted 282
7 SASI_Rn02_00223922 predicted 491
8 SASI_Rn02_00223923 predicted 587
9 SASI_Rn02_00223924 predicted 635
10 SASI_Rn02_00223925 predicted 1880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028701 predicted 1489
2 SASI_Mm01_00028702 predicted 679
3 SASI_Mm01_00028703 predicted 1239
4 SASI_Mm01_00028704 predicted 1808
5 SASI_Mm01_00028705 predicted 888
6 SASI_Mm01_00028706 predicted 1667
7 SASI_Mm01_00028707 predicted 558
8 SASI_Mm01_00028709 predicted 823
9 SASI_Mm01_00028710 predicted 1158
10 SASI_Mm02_00337784 predicted 1321
11 SASI_Mm01_00028708 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053206
MAGEE2 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family E, 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053206.1-1831s1c1
Sequence:CCGGCCCTTCTAATATCCTCTTTAACTCGAGTTAAAGAGGATATTAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-1312s1c1
Sequence:CCGGCCCAAGAATACTTGATGCCAACTCGAGTTGGCATCAAGTATTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-827s1c1
Sequence:CCGGCTGGCCAGTATATGGCACTAACTCGAGTTAGTGCCATATACTGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-1148s1c1
Sequence:CCGGCCAGGATGTGTTCCCAAATATCTCGAGATATTTGGGAACACATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-1524s1c1
Sequence:CCGGGCTCACCATGAAATCACCAAACTCGAGTTTGGTGATTTCATGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053206
MAGEE2 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family E, 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053206.1-1831s1c1
Sequence:CCGGCCCTTCTAATATCCTCTTTAACTCGAGTTAAAGAGGATATTAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-1312s1c1
Sequence:CCGGCCCAAGAATACTTGATGCCAACTCGAGTTGGCATCAAGTATTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-827s1c1
Sequence:CCGGCTGGCCAGTATATGGCACTAACTCGAGTTAGTGCCATATACTGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-1148s1c1
Sequence:CCGGCCAGGATGTGTTCCCAAATATCTCGAGATATTTGGGAACACATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-1524s1c1
Sequence:CCGGGCTCACCATGAAATCACCAAACTCGAGTTTGGTGATTTCATGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053206
MAGEE2 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family E, 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053206.1-1831s1c1
Sequence:CCGGCCCTTCTAATATCCTCTTTAACTCGAGTTAAAGAGGATATTAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-1312s1c1
Sequence:CCGGCCCAAGAATACTTGATGCCAACTCGAGTTGGCATCAAGTATTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-827s1c1
Sequence:CCGGCTGGCCAGTATATGGCACTAACTCGAGTTAGTGCCATATACTGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-1148s1c1
Sequence:CCGGCCAGGATGTGTTCCCAAATATCTCGAGATATTTGGGAACACATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053206.1-1524s1c1
Sequence:CCGGGCTCACCATGAAATCACCAAACTCGAGTTTGGTGATTTCATGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138703
MAGEE2 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family E, 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138703.3-1981s1c1
Sequence:CCGGCCCGGTCTTGTTTCAGCATAACTCGAGTTATGCTGAAACAAGACCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138703.3-1552s1c1
Sequence:CCGGCCTACTCTAATCCAGTTGAATCTCGAGATTCAACTGGATTAGAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138703.3-444s1c1
Sequence:CCGGCCTCTAGAAGACAGGTCGATTCTCGAGAATCGACCTGTCTTCTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138703.3-1241s1c1
Sequence:CCGGCCTCAATAGAGCTACTCTAATCTCGAGATTAGAGTAGCTCTATTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138703
MAGEE2 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family E, 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138703.3-1981s1c1
Sequence:CCGGCCCGGTCTTGTTTCAGCATAACTCGAGTTATGCTGAAACAAGACCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138703.3-1552s1c1
Sequence:CCGGCCTACTCTAATCCAGTTGAATCTCGAGATTCAACTGGATTAGAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138703.3-444s1c1
Sequence:CCGGCCTCTAGAAGACAGGTCGATTCTCGAGAATCGACCTGTCTTCTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138703.3-1241s1c1
Sequence:CCGGCCTCAATAGAGCTACTCTAATCTCGAGATTAGAGTAGCTCTATTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138703
MAGEE2 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family E, 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138703.3-1981s1c1
Sequence:CCGGCCCGGTCTTGTTTCAGCATAACTCGAGTTATGCTGAAACAAGACCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138703.3-1552s1c1
Sequence:CCGGCCTACTCTAATCCAGTTGAATCTCGAGATTCAACTGGATTAGAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138703.3-444s1c1
Sequence:CCGGCCTCTAGAAGACAGGTCGATTCTCGAGAATCGACCTGTCTTCTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138703.3-1241s1c1
Sequence:CCGGCCTCAATAGAGCTACTCTAATCTCGAGATTAGAGTAGCTCTATTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)