EMAIL THIS PAGE TO A FRIEND

MAGEF1

melanoma antigen family F, 1

44 Gene Product Result for
UniProtKB ID: Q9HAY2, Q9H215
Gene ID:
Human(64110) Summary: This intronless gene encodes a member of the MAGE superfamily. It is ubiquitously expressed in normal tissues and in tumor cells. This gene includes a microsatellite repeat in the coding region. [provided by RefSeq, Jul 2008]
Mouse(76222) melanoma antigen family F, 1
dog(488109) melanoma antigen family F, 1
cow(518728) melanoma antigen family F, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022149 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131651 MISSION® esiRNA esiRNA human MAGEF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022149 Rosetta Predictions human pricing
XR_002321 Rosetta Predictions mouse pricing
XR_005142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192425 predicted 406
2 SASI_Hs01_00192427 predicted 405
3 SASI_Hs01_00192419 predicted 435
4 SASI_Hs01_00192420 predicted 430
5 SASI_Hs01_00192421 predicted 1456
6 SASI_Hs02_00355563 predicted 1419
7 SASI_Hs01_00192422 predicted 1387
8 SASI_Hs01_00192423 predicted 405
9 SASI_Hs01_00192424 predicted 1388
10 SASI_Hs01_00192426 predicted 1439
11 SASI_Hs01_00192418 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_002321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00452927 predicted 276
2 SASI_Mm02_00452928 predicted 890
3 SASI_Mm02_00452929 predicted 498
4 SASI_Mm02_00452930 predicted 465
5 SASI_Mm02_00452931 predicted 937
6 SASI_Mm02_00452932 predicted 254
7 SASI_Mm02_00452933 predicted 328
8 SASI_Mm02_00452934 predicted 931
9 SASI_Mm02_00452935 predicted 672
10 SASI_Mm02_00452936 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00453552 predicted 521
2 SASI_Mm02_00453553 predicted 1143
3 SASI_Mm02_00453554 predicted 750
4 SASI_Mm02_00453555 predicted 717
5 SASI_Mm02_00453556 predicted 1193
6 SASI_Mm02_00453557 predicted 513
7 SASI_Mm02_00453558 predicted 583
8 SASI_Mm02_00453559 predicted 925
9 SASI_Mm02_00453560 predicted 868
10 SASI_Mm02_00453561 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022149
VALIDATED
MAGEF1 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family F, 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022149.3-705s1c1
Sequence:CCGGGCCTTATCTATATGAGAGGTACTCGAGTACCTCTCATATAGATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022149.3-577s1c1
Sequence:CCGGGCTGAAACAGTTTGACCGCAACTCGAGTTGCGGTCAAACTGTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022149.3-598s1c1
Sequence:CCGGGCACCACACTTACATCCTGATCTCGAGATCAGGATGTAAGTGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022149.3-775s1c1
Sequence:CCGGGCAACCCTCAAAGTATCATTTCTCGAGAAATGATACTTTGAGGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022149.3-876s1c1
Sequence:CCGGCCAATCCACCAGAATATGAATCTCGAGATTCATATTCTGGTGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022149.4-595s21c1
Sequence:CCGGAGCATCTGCGGTATGTCTTTGCTCGAGCAAAGACATACCGCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022149.4-850s21c1
Sequence:CCGGGGTATCCGAAGAGGCTTATTACTCGAGTAATAAGCCTCTTCGGATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022149.4-1251s21c1
Sequence:CCGGTCGTGTGACTTTAAGGATTTACTCGAGTAAATCCTTAAAGTCACACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022149.4-995s21c1
Sequence:CCGGGTTCGTGGCCAAACTGCATAACTCGAGTTATGCAGTTTGGCCACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022149
VALIDATED
MAGEF1 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family F, 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022149.3-705s1c1
Sequence:CCGGGCCTTATCTATATGAGAGGTACTCGAGTACCTCTCATATAGATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022149.3-577s1c1
Sequence:CCGGGCTGAAACAGTTTGACCGCAACTCGAGTTGCGGTCAAACTGTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022149.3-598s1c1
Sequence:CCGGGCACCACACTTACATCCTGATCTCGAGATCAGGATGTAAGTGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022149.3-775s1c1
Sequence:CCGGGCAACCCTCAAAGTATCATTTCTCGAGAAATGATACTTTGAGGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022149.3-876s1c1
Sequence:CCGGCCAATCCACCAGAATATGAATCTCGAGATTCATATTCTGGTGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022149.4-595s21c1
Sequence:CCGGAGCATCTGCGGTATGTCTTTGCTCGAGCAAAGACATACCGCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022149.4-850s21c1
Sequence:CCGGGGTATCCGAAGAGGCTTATTACTCGAGTAATAAGCCTCTTCGGATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022149.4-1251s21c1
Sequence:CCGGTCGTGTGACTTTAAGGATTTACTCGAGTAAATCCTTAAAGTCACACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022149.4-995s21c1
Sequence:CCGGGTTCGTGGCCAAACTGCATAACTCGAGTTATGCAGTTTGGCCACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022149
VALIDATED
MAGEF1 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family F, 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022149.3-705s1c1
Sequence:CCGGGCCTTATCTATATGAGAGGTACTCGAGTACCTCTCATATAGATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022149.3-577s1c1
Sequence:CCGGGCTGAAACAGTTTGACCGCAACTCGAGTTGCGGTCAAACTGTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022149.3-598s1c1
Sequence:CCGGGCACCACACTTACATCCTGATCTCGAGATCAGGATGTAAGTGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022149.3-775s1c1
Sequence:CCGGGCAACCCTCAAAGTATCATTTCTCGAGAAATGATACTTTGAGGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022149.3-876s1c1
Sequence:CCGGCCAATCCACCAGAATATGAATCTCGAGATTCATATTCTGGTGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022149.4-595s21c1
Sequence:CCGGAGCATCTGCGGTATGTCTTTGCTCGAGCAAAGACATACCGCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022149.4-850s21c1
Sequence:CCGGGGTATCCGAAGAGGCTTATTACTCGAGTAATAAGCCTCTTCGGATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022149.4-1251s21c1
Sequence:CCGGTCGTGTGACTTTAAGGATTTACTCGAGTAAATCCTTAAAGTCACACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022149.4-995s21c1
Sequence:CCGGGTTCGTGGCCAAACTGCATAACTCGAGTTATGCAGTTTGGCCACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)