EMAIL THIS PAGE TO A FRIEND

MAGEH1

melanoma antigen family H, 1

57 Gene Product Result for
Synonyms: APR-1 APR1 MAGEH
UniProtKB ID: Q9H213, B2R8V9, Q5JRJ3, Q9Y5M2
Gene ID:
Human(28986) Summary: This gene is thought to be involved in apoptosis. Multiple polyadenylation sites have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(75625) melanoma antigen, family H, 1
Rat(367767) melanoma antigen, family H, 1
dog(491904) melanoma antigen family H, 1
cow(514533) melanoma antigen family H, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014061 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014061 Rosetta Predictions human pricing
NM_001013250 Rosetta Predictions rat pricing
NM_023788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163031 predicted 1131
2 SASI_Hs02_00345080 predicted 1133
3 SASI_Hs02_00345081 predicted 1232
4 SASI_Hs01_00163026 predicted 777
5 SASI_Hs01_00163027 predicted 821
6 SASI_Hs01_00163029 predicted 1049
7 SASI_Hs01_00163032 predicted 813
8 SASI_Hs01_00163033 predicted 976
9 SASI_Hs01_00163034 predicted 587
10 SASI_Hs01_00163035 predicted 670
11 SASI_Hs01_00163028 predicted 841
12 SASI_Hs01_00163030 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036803 predicted 654
2 SASI_Rn01_00036804 predicted 478
3 SASI_Rn02_00201077 predicted 467
4 SASI_Rn01_00036805 predicted 307
5 SASI_Rn01_00036806 predicted 668
6 SASI_Rn01_00036807 predicted 510
7 SASI_Rn01_00036808 predicted 451
8 SASI_Rn01_00036809 predicted 275
9 SASI_Rn01_00036810 predicted 639
10 SASI_Rn01_00036812 predicted 357
11 SASI_Rn01_00036811 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067826 predicted 794
2 SASI_Mm01_00067828 predicted 647
3 SASI_Mm02_00327356 predicted 997
4 SASI_Mm02_00327357 predicted 1038
5 SASI_Mm01_00067829 predicted 596
6 SASI_Mm01_00067831 predicted 1080
7 SASI_Mm01_00067833 predicted 783
8 SASI_Mm01_00067834 predicted 726
9 SASI_Mm02_00327358 predicted 616
10 SASI_Mm02_00327359 predicted 789
11 SASI_Mm01_00067827 predicted 798
12 SASI_Mm01_00067830 predicted 412
13 SASI_Mm01_00067832 predicted 942
14 SASI_Mm01_00067835 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014061
MAGEH1 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family H, 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014061.3-664s21c1
Sequence:CCGGCCGAAGAAGATCGTCACAGAACTCGAGTTCTGTGACGATCTTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014061.3-843s21c1
Sequence:CCGGGCCTTGTAATTATGACTGGGACTCGAGTCCCAGTCATAATTACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014061.3-1192s21c1
Sequence:CCGGCCTGTCATTGACATTTAGTATCTCGAGATACTAAATGTCAATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014061.3-1192s1c1
Sequence:CCGGCCTGTCATTGACATTTAGTATCTCGAGATACTAAATGTCAATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-843s1c1
Sequence:CCGGGCCTTGTAATTATGACTGGGACTCGAGTCCCAGTCATAATTACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-774s1c1
Sequence:CCGGCGTGGAATCGAGCAAACTGAACTCGAGTTCAGTTTGCTCGATTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-844s1c1
Sequence:CCGGCCTTGTAATTATGACTGGGATCTCGAGATCCCAGTCATAATTACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014061.3-774s21c1
Sequence:CCGGCGTGGAATCGAGCAAACTGAACTCGAGTTCAGTTTGCTCGATTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-664s1c1
Sequence:CCGGCCGAAGAAGATCGTCACAGAACTCGAGTTCTGTGACGATCTTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014061
MAGEH1 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family H, 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014061.3-664s21c1
Sequence:CCGGCCGAAGAAGATCGTCACAGAACTCGAGTTCTGTGACGATCTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014061.3-843s21c1
Sequence:CCGGGCCTTGTAATTATGACTGGGACTCGAGTCCCAGTCATAATTACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014061.3-1192s21c1
Sequence:CCGGCCTGTCATTGACATTTAGTATCTCGAGATACTAAATGTCAATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014061.3-1192s1c1
Sequence:CCGGCCTGTCATTGACATTTAGTATCTCGAGATACTAAATGTCAATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-843s1c1
Sequence:CCGGGCCTTGTAATTATGACTGGGACTCGAGTCCCAGTCATAATTACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-774s1c1
Sequence:CCGGCGTGGAATCGAGCAAACTGAACTCGAGTTCAGTTTGCTCGATTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-844s1c1
Sequence:CCGGCCTTGTAATTATGACTGGGATCTCGAGATCCCAGTCATAATTACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014061.3-774s21c1
Sequence:CCGGCGTGGAATCGAGCAAACTGAACTCGAGTTCAGTTTGCTCGATTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-664s1c1
Sequence:CCGGCCGAAGAAGATCGTCACAGAACTCGAGTTCTGTGACGATCTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014061
MAGEH1 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family H, 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014061.3-664s21c1
Sequence:CCGGCCGAAGAAGATCGTCACAGAACTCGAGTTCTGTGACGATCTTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014061.3-843s21c1
Sequence:CCGGGCCTTGTAATTATGACTGGGACTCGAGTCCCAGTCATAATTACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014061.3-1192s21c1
Sequence:CCGGCCTGTCATTGACATTTAGTATCTCGAGATACTAAATGTCAATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014061.3-1192s1c1
Sequence:CCGGCCTGTCATTGACATTTAGTATCTCGAGATACTAAATGTCAATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-843s1c1
Sequence:CCGGGCCTTGTAATTATGACTGGGACTCGAGTCCCAGTCATAATTACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-774s1c1
Sequence:CCGGCGTGGAATCGAGCAAACTGAACTCGAGTTCAGTTTGCTCGATTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-844s1c1
Sequence:CCGGCCTTGTAATTATGACTGGGATCTCGAGATCCCAGTCATAATTACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014061.3-774s21c1
Sequence:CCGGCGTGGAATCGAGCAAACTGAACTCGAGTTCAGTTTGCTCGATTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014061.3-664s1c1
Sequence:CCGGCCGAAGAAGATCGTCACAGAACTCGAGTTCTGTGACGATCTTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023788
MAGEH1 MISSION shRNA Bacterial Glycerol Stock
melanoma antigen family H, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-60s1c1
Sequence:CCGGGCTGAAGAGAATCGCAACAATCTCGAGATTGTTGCGATTCTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-585s1c1
Sequence:CCGGCCATGTAACTATGACTGGGATCTCGAGATCCCAGTCATAGTTACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023788.2-683s1c1
Sequence:CCGGGCAAACCCTTAGGAGTGGAAACTCGAGTTTCCACTCCTAAGGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-515s1c1
Sequence:CCGGCGTGGAATCTAGCAAGCTGAACTCGAGTTCAGCTTGCTAGATTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-405s1c1
Sequence:CCGGCCGAAGAAGGTCGTTACAGAACTCGAGTTCTGTAACGACCTTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023788
MAGEH1 MISSION shRNA shRNA Plasmid DNA
melanoma antigen family H, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-60s1c1
Sequence:CCGGGCTGAAGAGAATCGCAACAATCTCGAGATTGTTGCGATTCTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-585s1c1
Sequence:CCGGCCATGTAACTATGACTGGGATCTCGAGATCCCAGTCATAGTTACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023788.2-683s1c1
Sequence:CCGGGCAAACCCTTAGGAGTGGAAACTCGAGTTTCCACTCCTAAGGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-515s1c1
Sequence:CCGGCGTGGAATCTAGCAAGCTGAACTCGAGTTCAGCTTGCTAGATTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-405s1c1
Sequence:CCGGCCGAAGAAGGTCGTTACAGAACTCGAGTTCTGTAACGACCTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023788
MAGEH1 MISSION shRNA Lentiviral Transduction Particles
melanoma antigen family H, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-60s1c1
Sequence:CCGGGCTGAAGAGAATCGCAACAATCTCGAGATTGTTGCGATTCTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-585s1c1
Sequence:CCGGCCATGTAACTATGACTGGGATCTCGAGATCCCAGTCATAGTTACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023788.2-683s1c1
Sequence:CCGGGCAAACCCTTAGGAGTGGAAACTCGAGTTTCCACTCCTAAGGGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-515s1c1
Sequence:CCGGCGTGGAATCTAGCAAGCTGAACTCGAGTTCAGCTTGCTAGATTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023788.2-405s1c1
Sequence:CCGGCCGAAGAAGGTCGTTACAGAACTCGAGTTCTGTAACGACCTTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)