EMAIL THIS PAGE TO A FRIEND

MAGI1

membrane associated guanylate kinase, WW and PDZ domain containing 1

181 Gene Product Result for
Synonyms: AIP-3 AIP3 BAIAP1 BAP-1 BAP1 MAGI-1 TNRC19 WWP3
UniProtKB ID: Q96QZ7, O00309, O43863, O75085, Q96QZ8, Q96QZ9
Gene ID:
Human(9223) Summary: The protein encoded by this gene is a member of the membrane-associated guanylate kinase homologue (MAGUK) family. MAGUK proteins participate in the assembly of multiprotein complexes on the inner surface of the plasma membrane at regions of cell-cell contact. The product of this gene may play a role as scaffolding protein at cell-cell junctions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(14924) membrane associated guanylate kinase, WW and PDZ domain containing 1
Rat(500261) membrane associated guanylate kinase, WW and PDZ domain containing 1
chicken(416083) membrane associated guanylate kinase, WW and PDZ domain containing 1
dog(476565) membrane associated guanylate kinase, WW and PDZ domain containing 1
domestic cat(101086887) membrane associated guanylate kinase, WW and PDZ domain containing 1
cow(783484) membrane associated guanylate kinase, WW and PDZ domain containing 1
sheep(101118390) membrane associated guanylate kinase, WW and PDZ domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004742 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033057 Rosetta Predictions human pricing
NM_004742 Rosetta Predictions human pricing
NM_015520 Rosetta Predictions human pricing
NM_001030045 Rosetta Predictions rat pricing
NM_001029850 Rosetta Predictions mouse pricing
NM_001083320 Rosetta Predictions mouse pricing
NM_001083321 Rosetta Predictions mouse pricing
NM_010367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085343 predicted 3910
2 SASI_Hs01_00085344 predicted 3819
3 SASI_Hs02_00307994 predicted 1266
4 SASI_Hs01_00085345 predicted 2066
5 SASI_Hs01_00085346 predicted 3869
6 SASI_Hs01_00085347 predicted 918
7 SASI_Hs01_00085348 predicted 1380
8 SASI_Hs01_00085349 predicted 913
9 SASI_Hs01_00085350 predicted 1328
10 SASI_Hs01_00085352 predicted 3829
11 SASI_Hs01_00085351 predicted 2291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086970 predicted 3997
2 SASI_Hs01_00086971 predicted 3903
3 SASI_Hs02_00338224 predicted 1275
4 SASI_Hs01_00086972 predicted 2065
5 SASI_Hs01_00086973 predicted 3953
6 SASI_Hs01_00086974 predicted 921
7 SASI_Hs01_00086975 predicted 1372
8 SASI_Hs01_00086976 predicted 916
9 SASI_Hs01_00086977 predicted 1333
10 SASI_Hs01_00086979 predicted 3918
11 SASI_Hs01_00086978 predicted 2293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044614 predicted 3994
2 SASI_Hs01_00044615 predicted 3900
3 SASI_Hs02_00348013 predicted 1273
4 SASI_Hs01_00044616 predicted 2074
5 SASI_Hs01_00044617 predicted 3953
6 SASI_Hs01_00044618 predicted 926
7 SASI_Hs01_00044619 predicted 1380
8 SASI_Hs01_00044620 predicted 916
9 SASI_Hs01_00044621 predicted 1327
10 SASI_Hs01_00044623 predicted 3918
11 SASI_Hs01_00044622 predicted 2299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033572 predicted 3422
2 SASI_Rn01_00033573 predicted 858
3 SASI_Rn01_00033574 predicted 3504
4 SASI_Rn01_00033576 predicted 2454
5 SASI_Rn01_00033577 predicted 2099
6 SASI_Rn01_00033578 predicted 3374
7 SASI_Rn01_00033579 predicted 3202
8 SASI_Rn02_00203559 predicted 2109
9 SASI_Rn02_00203560 predicted 467
10 SASI_Rn02_00203561 predicted 1728
11 SASI_Rn01_00033571 predicted 1731
12 SASI_Rn01_00033575 predicted 3215
13 SASI_Rn01_00033580 predicted 3237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288020 predicted 3292
2 SASI_Mm02_00288021 predicted 2318
3 SASI_Mm01_00076010 predicted 2290
4 SASI_Mm02_00288022 predicted 2208
5 SASI_Mm02_00288023 predicted 2057
6 SASI_Mm02_00288024 predicted 2109
7 SASI_Mm02_00288025 predicted 1270
8 SASI_Mm01_00076015 predicted 2248
9 SASI_Mm02_00288026 predicted 1240
10 SASI_Mm02_00288027 predicted 3303
11 SASI_Mm01_00076009 predicted 864
12 SASI_Mm01_00076011 predicted 3331
13 SASI_Mm01_00076012 predicted 883
14 SASI_Mm01_00076013 predicted 4149
15 SASI_Mm01_00076014 predicted 3449
16 SASI_Mm01_00076016 predicted 2716
17 SASI_Mm01_00076017 predicted 3539
18 SASI_Mm01_00076018 predicted 3771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299621 predicted 2643
2 SASI_Mm02_00299622 predicted 1460
3 SASI_Mm02_00299623 predicted 1675
4 SASI_Mm02_00299624 predicted 1650
5 SASI_Mm02_00299625 predicted 1570
6 SASI_Mm02_00299626 predicted 1412
7 SASI_Mm02_00299627 predicted 1463
8 SASI_Mm02_00299628 predicted 624
9 SASI_Mm02_00299629 predicted 1603
10 SASI_Mm02_00299630 predicted 2665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299631 predicted 2510
2 SASI_Mm02_00299632 predicted 1325
3 SASI_Mm02_00299633 predicted 1538
4 SASI_Mm02_00299634 predicted 1506
5 SASI_Mm02_00299635 predicted 1426
6 SASI_Mm02_00299636 predicted 1274
7 SASI_Mm02_00299637 predicted 1328
8 SASI_Mm02_00299638 predicted 496
9 SASI_Mm02_00299639 predicted 1464
10 SASI_Mm02_00299640 predicted 2533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318418 predicted 3165
2 SASI_Mm02_00318419 predicted 2065
3 SASI_Mm02_00318420 predicted 2281
4 SASI_Mm02_00318421 predicted 2255
5 SASI_Mm02_00318422 predicted 2174
6 SASI_Mm02_00318423 predicted 2019
7 SASI_Mm02_00318424 predicted 2073
8 SASI_Mm02_00318425 predicted 1276
9 SASI_Mm02_00318426 predicted 2214
10 SASI_Mm02_00318427 predicted 1240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004742
VALIDATED
MAGI1 MISSION shRNA Bacterial Glycerol Stock
membrane associated guanylate kinase, WW and PDZ domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004742.2-4449s21c1
Sequence:GTACCGGTGGCCTAAGACAAGATCTTTACTCGAGTAAAGATCTTGTCTTAGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-1065s21c1
Sequence:CCGGGCACCTATGAAGGAAACTATTCTCGAGAATAGTTTCCTTCATAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004742.2-5796s21c1
Sequence:CCGGAGAGTCACAAATGGGTTATAACTCGAGTTATAACCCATTTGTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-4166s21c1
Sequence:CCGGCGAGCTATAGAACTGATTAAGCTCGAGCTTAATCAGTTCTATAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-4023s21c1
Sequence:CCGGTTCGAGGAGGCCGAGAGTATACTCGAGTATACTCTCGGCCTCCTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-985s21c1
Sequence:CCGGAGTGCCTGGCGTGGACTATAACTCGAGTTATAGTCCACGCCAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-850s21c1
Sequence:CCGGGAACAAGGACCTGCGACATTTCTCGAGAAATGTCGCAGGTCCTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004742.2-5513s1c2
Sequence:CCGGCCACTGAAACTGTGTAACATTCTCGAGAATGTTACACAGTTTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004742.2-1636s1c2
Sequence:CCGGCCCTGTCTATGGTATCTACTACTCGAGTAGTAGATACCATAGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-1185s21c1
Sequence:GTACCGGAGCGAACCAAGTCCTACAATGCTCGAGCATTGTAGGACTTGGTTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004742.2-2185s1c1
Sequence:CCGGCCGAGGTTATCCATTGCCTTTCTCGAGAAAGGCAATGGATAACCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004742.2-4037s1c1
Sequence:CCGGGAGTATAACATGGACCTCTATCTCGAGATAGAGGTCCATGTTATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004742.2-1065s1c1
Sequence:CCGGGCACCTATGAAGGAAACTATTCTCGAGAATAGTTTCCTTCATAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004742
VALIDATED
MAGI1 MISSION shRNA shRNA Plasmid DNA
membrane associated guanylate kinase, WW and PDZ domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004742.2-4449s21c1
Sequence:GTACCGGTGGCCTAAGACAAGATCTTTACTCGAGTAAAGATCTTGTCTTAGGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-1065s21c1
Sequence:CCGGGCACCTATGAAGGAAACTATTCTCGAGAATAGTTTCCTTCATAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004742.2-5796s21c1
Sequence:CCGGAGAGTCACAAATGGGTTATAACTCGAGTTATAACCCATTTGTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-4166s21c1
Sequence:CCGGCGAGCTATAGAACTGATTAAGCTCGAGCTTAATCAGTTCTATAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-4023s21c1
Sequence:CCGGTTCGAGGAGGCCGAGAGTATACTCGAGTATACTCTCGGCCTCCTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-985s21c1
Sequence:CCGGAGTGCCTGGCGTGGACTATAACTCGAGTTATAGTCCACGCCAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-850s21c1
Sequence:CCGGGAACAAGGACCTGCGACATTTCTCGAGAAATGTCGCAGGTCCTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004742.2-5513s1c2
Sequence:CCGGCCACTGAAACTGTGTAACATTCTCGAGAATGTTACACAGTTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004742.2-1636s1c2
Sequence:CCGGCCCTGTCTATGGTATCTACTACTCGAGTAGTAGATACCATAGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-1185s21c1
Sequence:GTACCGGAGCGAACCAAGTCCTACAATGCTCGAGCATTGTAGGACTTGGTTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004742.2-2185s1c1
Sequence:CCGGCCGAGGTTATCCATTGCCTTTCTCGAGAAAGGCAATGGATAACCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004742.2-4037s1c1
Sequence:CCGGGAGTATAACATGGACCTCTATCTCGAGATAGAGGTCCATGTTATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004742.2-1065s1c1
Sequence:CCGGGCACCTATGAAGGAAACTATTCTCGAGAATAGTTTCCTTCATAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004742
VALIDATED
MAGI1 MISSION shRNA Lentiviral Transduction Particles
membrane associated guanylate kinase, WW and PDZ domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004742.2-4449s21c1
Sequence:GTACCGGTGGCCTAAGACAAGATCTTTACTCGAGTAAAGATCTTGTCTTAGGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-1065s21c1
Sequence:CCGGGCACCTATGAAGGAAACTATTCTCGAGAATAGTTTCCTTCATAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004742.2-5796s21c1
Sequence:CCGGAGAGTCACAAATGGGTTATAACTCGAGTTATAACCCATTTGTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-4166s21c1
Sequence:CCGGCGAGCTATAGAACTGATTAAGCTCGAGCTTAATCAGTTCTATAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-4023s21c1
Sequence:CCGGTTCGAGGAGGCCGAGAGTATACTCGAGTATACTCTCGGCCTCCTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-985s21c1
Sequence:CCGGAGTGCCTGGCGTGGACTATAACTCGAGTTATAGTCCACGCCAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-850s21c1
Sequence:CCGGGAACAAGGACCTGCGACATTTCTCGAGAAATGTCGCAGGTCCTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004742.2-5513s1c2
Sequence:CCGGCCACTGAAACTGTGTAACATTCTCGAGAATGTTACACAGTTTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004742.2-1636s1c2
Sequence:CCGGCCCTGTCTATGGTATCTACTACTCGAGTAGTAGATACCATAGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004742.2-1185s21c1
Sequence:GTACCGGAGCGAACCAAGTCCTACAATGCTCGAGCATTGTAGGACTTGGTTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004742.2-2185s1c1
Sequence:CCGGCCGAGGTTATCCATTGCCTTTCTCGAGAAAGGCAATGGATAACCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004742.2-4037s1c1
Sequence:CCGGGAGTATAACATGGACCTCTATCTCGAGATAGAGGTCCATGTTATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004742.2-1065s1c1
Sequence:CCGGGCACCTATGAAGGAAACTATTCTCGAGAATAGTTTCCTTCATAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010367
VALIDATED
MAGI1 MISSION shRNA Bacterial Glycerol Stock
membrane associated guanylate kinase, WW and PDZ domain containing 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-2430s21c1
Sequence:CCGGCACCCAGCCAGAGCTAATAACCTCGAGGTTATTAGCTCTGGCTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-2201s21c1
Sequence:CCGGTTGACCCGGATGACCCTAATACTCGAGTATTAGGGTCATCCGGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010367.2-5621s21c1
Sequence:CCGGAGCCGAGTAGATCCGAATATACTCGAGTATATTCGGATCTACTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-2248s21c1
Sequence:CCGGTTGGACAAAGAACCAATTATTCTCGAGAATAATTGGTTCTTTGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-1241s21c1
Sequence:CCGGAGCGAACAAAGTCCTACAATGCTCGAGCATTGTAGGACTTTGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010367.2-906s21c1
Sequence:CCGGCAACAAGGACCTACGACATTTCTCGAGAAATGTCGTAGGTCCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-3106s21c1
Sequence:CCGGGTGGATGGGACACCAGTAATTCTCGAGAATTACTGGTGTCCCATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-4529s21c1
Sequence:CCGGCGAAAGACTCCTGGATCAAAGCTCGAGCTTTGATCCAGGAGTCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010367.1-4745s1c1
Sequence:CCGGGCGCTGACAACACTTTGGAAACTCGAGTTTCCAAAGTGTTGTCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010367.1-4081s1c1
Sequence:CCGGCGAGAATATAACATGGATCTTCTCGAGAAGATCCATGTTATATTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010367.1-1657s1c1
Sequence:CCGGCCTGAAATGAACAGTAGCTTTCTCGAGAAAGCTACTGTTCATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010367.1-2957s1c1
Sequence:CCGGCGCACAATCAAGTCGTGGATACTCGAGTATCCACGACTTGATTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010367.1-2958s1c1
Sequence:CCGGGCACAATCAAGTCGTGGATATCTCGAGATATCCACGACTTGATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010367
VALIDATED
MAGI1 MISSION shRNA shRNA Plasmid DNA
membrane associated guanylate kinase, WW and PDZ domain containing 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-2430s21c1
Sequence:CCGGCACCCAGCCAGAGCTAATAACCTCGAGGTTATTAGCTCTGGCTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-2201s21c1
Sequence:CCGGTTGACCCGGATGACCCTAATACTCGAGTATTAGGGTCATCCGGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010367.2-5621s21c1
Sequence:CCGGAGCCGAGTAGATCCGAATATACTCGAGTATATTCGGATCTACTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-2248s21c1
Sequence:CCGGTTGGACAAAGAACCAATTATTCTCGAGAATAATTGGTTCTTTGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-1241s21c1
Sequence:CCGGAGCGAACAAAGTCCTACAATGCTCGAGCATTGTAGGACTTTGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010367.2-906s21c1
Sequence:CCGGCAACAAGGACCTACGACATTTCTCGAGAAATGTCGTAGGTCCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-3106s21c1
Sequence:CCGGGTGGATGGGACACCAGTAATTCTCGAGAATTACTGGTGTCCCATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-4529s21c1
Sequence:CCGGCGAAAGACTCCTGGATCAAAGCTCGAGCTTTGATCCAGGAGTCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010367.1-4745s1c1
Sequence:CCGGGCGCTGACAACACTTTGGAAACTCGAGTTTCCAAAGTGTTGTCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010367.1-4081s1c1
Sequence:CCGGCGAGAATATAACATGGATCTTCTCGAGAAGATCCATGTTATATTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010367.1-1657s1c1
Sequence:CCGGCCTGAAATGAACAGTAGCTTTCTCGAGAAAGCTACTGTTCATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010367.1-2957s1c1
Sequence:CCGGCGCACAATCAAGTCGTGGATACTCGAGTATCCACGACTTGATTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010367.1-2958s1c1
Sequence:CCGGGCACAATCAAGTCGTGGATATCTCGAGATATCCACGACTTGATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010367
VALIDATED
MAGI1 MISSION shRNA Lentiviral Transduction Particles
membrane associated guanylate kinase, WW and PDZ domain containing 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-2430s21c1
Sequence:CCGGCACCCAGCCAGAGCTAATAACCTCGAGGTTATTAGCTCTGGCTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-2201s21c1
Sequence:CCGGTTGACCCGGATGACCCTAATACTCGAGTATTAGGGTCATCCGGGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010367.2-5621s21c1
Sequence:CCGGAGCCGAGTAGATCCGAATATACTCGAGTATATTCGGATCTACTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-2248s21c1
Sequence:CCGGTTGGACAAAGAACCAATTATTCTCGAGAATAATTGGTTCTTTGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-1241s21c1
Sequence:CCGGAGCGAACAAAGTCCTACAATGCTCGAGCATTGTAGGACTTTGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010367.2-906s21c1
Sequence:CCGGCAACAAGGACCTACGACATTTCTCGAGAAATGTCGTAGGTCCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-3106s21c1
Sequence:CCGGGTGGATGGGACACCAGTAATTCTCGAGAATTACTGGTGTCCCATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010367.2-4529s21c1
Sequence:CCGGCGAAAGACTCCTGGATCAAAGCTCGAGCTTTGATCCAGGAGTCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010367.1-4745s1c1
Sequence:CCGGGCGCTGACAACACTTTGGAAACTCGAGTTTCCAAAGTGTTGTCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010367.1-4081s1c1
Sequence:CCGGCGAGAATATAACATGGATCTTCTCGAGAAGATCCATGTTATATTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010367.1-1657s1c1
Sequence:CCGGCCTGAAATGAACAGTAGCTTTCTCGAGAAAGCTACTGTTCATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010367.1-2957s1c1
Sequence:CCGGCGCACAATCAAGTCGTGGATACTCGAGTATCCACGACTTGATTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010367.1-2958s1c1
Sequence:CCGGGCACAATCAAGTCGTGGATATCTCGAGATATCCACGACTTGATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)