EMAIL THIS PAGE TO A FRIEND

MAGI2

membrane associated guanylate kinase, WW and PDZ domain containing 2

196 Gene Product Result for
Synonyms: ACVRIP1 AIP-1 AIP1 ARIP1 MAGI-2 SSCAM
Gene ID:
Human(9863) Summary: The protein encoded by this gene interacts with atrophin-1. Atrophin-1 contains a polyglutamine repeat, expansion of which is responsible for dentatorubral and pallidoluysian atrophy. This encoded protein is characterized by two WW domains, a guanylate kinase-like domain, and multiple PDZ domains. It has structural similarity to the membrane-associated guanylate kinase homologue (MAGUK) family. [provided by RefSeq, Jul 2008]
Mouse(50791) membrane associated guanylate kinase, WW and PDZ domain containing 2
Rat(113970) membrane associated guanylate kinase, WW and PDZ domain containing 2
Zebrafish(564112) membrane associated guanylate kinase, WW and PDZ domain containing 2
cow(100298336) membrane associated guanylate kinase, WW and PDZ domain containing 2
domestic cat(101091354) membrane associated guanylate kinase, WW and PDZ domain containing 2
dog(475904) membrane associated guanylate kinase, WW and PDZ domain containing 2
chicken(417729) membrane associated guanylate kinase, WW and PDZ domain containing 2
domestic guinea pig(100726657) membrane associated guanylate kinase, WW and PDZ domain containing 2
naked mole-rat(101701319) membrane associated guanylate kinase, WW and PDZ domain containing 2
sheep(101102476) membrane associated guanylate kinase, WW and PDZ domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012301 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076621 MISSION® esiRNA esiRNA human MAGI2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012301 Rosetta Predictions human pricing
NM_053621 Rosetta Predictions rat pricing
NM_015823 Rosetta Predictions mouse pricing
XM_001000863 Rosetta Predictions mouse pricing
XM_001000876 Rosetta Predictions mouse pricing
XM_001000890 Rosetta Predictions mouse pricing
XM_001000904 Rosetta Predictions mouse pricing
XM_001000915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038313 predicted 3872
2 SASI_Hs01_00038314 predicted 1204
3 SASI_Hs01_00038315 predicted 2233
4 SASI_Hs01_00038316 predicted 3760
5 SASI_Hs01_00038317 predicted 544
6 SASI_Hs01_00038318 predicted 2571
7 SASI_Hs01_00038319 predicted 1065
8 SASI_Hs01_00038320 predicted 2487
9 SASI_Hs01_00038321 predicted 779
10 SASI_Hs01_00038322 predicted 1863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053884 predicted 2120
2 SASI_Rn01_00053885 predicted 1950
3 SASI_Rn01_00053886 predicted 1438
4 SASI_Rn01_00053887 predicted 1986
5 SASI_Rn02_00266327 predicted 1912
6 SASI_Rn01_00053889 predicted 1877
7 SASI_Rn01_00053890 predicted 2708
8 SASI_Rn01_00053891 predicted 3705
9 SASI_Rn01_00053892 predicted 886
10 SASI_Rn02_00266328 predicted 2383
11 SASI_Rn01_00053888 predicted 874
12 SASI_Rn01_00053893 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323226 predicted 1362
2 SASI_Mm02_00323227 predicted 259
3 SASI_Mm02_00323228 predicted 2652
4 SASI_Mm02_00323229 predicted 2630
5 SASI_Mm02_00323230 predicted 1606
6 SASI_Mm02_00323231 predicted 1543
7 SASI_Mm02_00323232 predicted 2284
8 SASI_Mm02_00323233 predicted 3190
9 SASI_Mm02_00323234 predicted 807
10 SASI_Mm02_00323235 predicted 1738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270477 predicted 866
2 SASI_Mm01_00270478 predicted 693
3 SASI_Mm01_00270479 predicted 1993
4 SASI_Mm01_00270480 predicted 1963
5 SASI_Mm01_00270481 predicted 940
6 SASI_Mm01_00270482 predicted 395
7 SASI_Mm01_00270483 predicted 873
8 SASI_Mm01_00270484 predicted 1623
9 SASI_Mm01_00270485 predicted 1014
10 SASI_Mm01_00270486 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279082 predicted 2120
2 SASI_Mm01_00279083 predicted 1948
3 SASI_Mm01_00279084 predicted 3246
4 SASI_Mm01_00279085 predicted 3218
5 SASI_Mm01_00279086 predicted 2192
6 SASI_Mm01_00279087 predicted 4595
7 SASI_Mm01_00279088 predicted 1654
8 SASI_Mm01_00279089 predicted 2873
9 SASI_Mm01_00279090 predicted 1387
10 SASI_Mm01_00279091 predicted 2326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209659 predicted 898
2 SASI_Mm01_00209660 predicted 650
3 SASI_Mm01_00209661 predicted 646
4 SASI_Mm01_00209662 predicted 606
5 SASI_Mm01_00209663 predicted 883
6 SASI_Mm01_00209664 predicted 606
7 SASI_Mm01_00209665 predicted 599
8 SASI_Mm01_00209666 predicted 652
9 SASI_Mm01_00209667 predicted 742
10 SASI_Mm01_00209668 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265189 predicted 1877
2 SASI_Mm01_00265190 predicted 1709
3 SASI_Mm01_00265191 predicted 609
4 SASI_Mm01_00265192 predicted 2961
5 SASI_Mm01_00265193 predicted 2936
6 SASI_Mm01_00265194 predicted 1954
7 SASI_Mm01_00265195 predicted 1412
8 SASI_Mm01_00265196 predicted 2589
9 SASI_Mm01_00265197 predicted 3643
10 SASI_Mm01_00265198 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253368 predicted 1881
2 SASI_Mm01_00253369 predicted 1703
3 SASI_Mm01_00253370 predicted 602
4 SASI_Mm01_00253371 predicted 3000
5 SASI_Mm01_00253372 predicted 2974
6 SASI_Mm01_00253373 predicted 1953
7 SASI_Mm01_00253374 predicted 1410
8 SASI_Mm01_00253375 predicted 2635
9 SASI_Mm01_00253376 predicted 3683
10 SASI_Mm01_00253377 predicted 1149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012301
MAGI2 MISSION shRNA Bacterial Glycerol Stock
membrane associated guanylate kinase, WW and PDZ domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012301.2-3716s1c1
Sequence:CCGGCAAAGGATTTGGATTCAGCATCTCGAGATGCTGAATCCAAATCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012301.2-2052s1c1
Sequence:CCGGCAAGCTGAACTTATGACCTTACTCGAGTAAGGTCATAAGTTCAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012301.3-5846s21c1
Sequence:CCGGTATGATTGACCTCCTAGTAAACTCGAGTTTACTAGGAGGTCAATCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-2358s21c1
Sequence:CCGGGGCAGTCCTCAAACGAGTTTACTCGAGTAAACTCGTTTGAGGACTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-3815s21c1
Sequence:CCGGGATGAGGGTAGGAGATCAAATCTCGAGATTTGATCTCCTACCCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-577s21c1
Sequence:CCGGTTCGTCACTACCTCAACTTACCTCGAGGTAAGTTGAGGTAGTGACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-700s21c1
Sequence:CCGGAGGTCCCTGGAGTGGATTATACTCGAGTATAATCCACTCCAGGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012301
MAGI2 MISSION shRNA shRNA Plasmid DNA
membrane associated guanylate kinase, WW and PDZ domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012301.2-3716s1c1
Sequence:CCGGCAAAGGATTTGGATTCAGCATCTCGAGATGCTGAATCCAAATCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012301.2-2052s1c1
Sequence:CCGGCAAGCTGAACTTATGACCTTACTCGAGTAAGGTCATAAGTTCAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012301.3-5846s21c1
Sequence:CCGGTATGATTGACCTCCTAGTAAACTCGAGTTTACTAGGAGGTCAATCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-2358s21c1
Sequence:CCGGGGCAGTCCTCAAACGAGTTTACTCGAGTAAACTCGTTTGAGGACTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-3815s21c1
Sequence:CCGGGATGAGGGTAGGAGATCAAATCTCGAGATTTGATCTCCTACCCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-577s21c1
Sequence:CCGGTTCGTCACTACCTCAACTTACCTCGAGGTAAGTTGAGGTAGTGACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-700s21c1
Sequence:CCGGAGGTCCCTGGAGTGGATTATACTCGAGTATAATCCACTCCAGGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012301
MAGI2 MISSION shRNA Lentiviral Transduction Particles
membrane associated guanylate kinase, WW and PDZ domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012301.2-3716s1c1
Sequence:CCGGCAAAGGATTTGGATTCAGCATCTCGAGATGCTGAATCCAAATCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012301.2-2052s1c1
Sequence:CCGGCAAGCTGAACTTATGACCTTACTCGAGTAAGGTCATAAGTTCAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012301.3-5846s21c1
Sequence:CCGGTATGATTGACCTCCTAGTAAACTCGAGTTTACTAGGAGGTCAATCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-2358s21c1
Sequence:CCGGGGCAGTCCTCAAACGAGTTTACTCGAGTAAACTCGTTTGAGGACTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-3815s21c1
Sequence:CCGGGATGAGGGTAGGAGATCAAATCTCGAGATTTGATCTCCTACCCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-577s21c1
Sequence:CCGGTTCGTCACTACCTCAACTTACCTCGAGGTAAGTTGAGGTAGTGACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012301.3-700s21c1
Sequence:CCGGAGGTCCCTGGAGTGGATTATACTCGAGTATAATCCACTCCAGGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015823
MAGI2 MISSION shRNA Bacterial Glycerol Stock
membrane associated guanylate kinase, WW and PDZ domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015823.2-4154s21c1
Sequence:CCGGTGTCACACGCATAGATCTATACTCGAGTATAGATCTATGCGTGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-302s21c1
Sequence:CCGGAGCTGAACCAGCACCATTATTCTCGAGAATAATGGTGCTGGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-1345s21c1
Sequence:CCGGTCAATGGAAGACATAACTATGCTCGAGCATAGTTATGTCTTCCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-1958s21c1
Sequence:CCGGATATGAGCTCTACGAGAAATCCTCGAGGATTTCTCGTAGAGCTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-1396s21c1
Sequence:CCGGCACAGTCGGTCCCAGATATTACTCGAGTAATATCTGGGACCGACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015823
MAGI2 MISSION shRNA shRNA Plasmid DNA
membrane associated guanylate kinase, WW and PDZ domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015823.2-4154s21c1
Sequence:CCGGTGTCACACGCATAGATCTATACTCGAGTATAGATCTATGCGTGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-302s21c1
Sequence:CCGGAGCTGAACCAGCACCATTATTCTCGAGAATAATGGTGCTGGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-1345s21c1
Sequence:CCGGTCAATGGAAGACATAACTATGCTCGAGCATAGTTATGTCTTCCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-1958s21c1
Sequence:CCGGATATGAGCTCTACGAGAAATCCTCGAGGATTTCTCGTAGAGCTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-1396s21c1
Sequence:CCGGCACAGTCGGTCCCAGATATTACTCGAGTAATATCTGGGACCGACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015823
MAGI2 MISSION shRNA Lentiviral Transduction Particles
membrane associated guanylate kinase, WW and PDZ domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015823.2-4154s21c1
Sequence:CCGGTGTCACACGCATAGATCTATACTCGAGTATAGATCTATGCGTGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-302s21c1
Sequence:CCGGAGCTGAACCAGCACCATTATTCTCGAGAATAATGGTGCTGGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-1345s21c1
Sequence:CCGGTCAATGGAAGACATAACTATGCTCGAGCATAGTTATGTCTTCCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-1958s21c1
Sequence:CCGGATATGAGCTCTACGAGAAATCCTCGAGGATTTCTCGTAGAGCTCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015823.2-1396s21c1
Sequence:CCGGCACAGTCGGTCCCAGATATTACTCGAGTAATATCTGGGACCGACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)