EMAIL THIS PAGE TO A FRIEND

MAGI3

membrane associated guanylate kinase, WW and PDZ domain containing 3

140 Gene Product Result for
Synonyms: MAGI-3 RP4-730K3.1 dJ730K3.2
Gene ID:
Mouse(99470) membrane associated guanylate kinase, WW and PDZ domain containing 3
Rat(245903) membrane associated guanylate kinase, WW and PDZ domain containing 3
Zebrafish(561689) membrane associated guanylate kinase, WW and PDZ domain containing 3
chicken(419877) membrane associated guanylate kinase, WW and PDZ domain containing 3
cow(532952) membrane associated guanylate kinase, WW and PDZ domain containing 3
Horse(100064709) membrane associated guanylate kinase, WW and PDZ domain containing 3
domestic cat(101081654) membrane associated guanylate kinase, WW and PDZ domain containing 3
dog(483214) membrane associated guanylate kinase, WW and PDZ domain containing 3
sheep(101118910) membrane associated guanylate kinase, WW and PDZ domain containing 3
naked mole-rat(101710594) membrane associated guanylate kinase, WW and PDZ domain containing 3
Domestic Rabbit(100347584) membrane associated guanylate kinase, WW and PDZ domain containing 3
domestic guinea pig(100716414) membrane associated guanylate kinase, WW and PDZ domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152900 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020965 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020965 Rosetta Predictions human pricing
NM_152900 Rosetta Predictions human pricing
NM_139084 Rosetta Predictions rat pricing
NM_133853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242738 predicted 2909
2 SASI_Hs01_00242739 predicted 2111
3 SASI_Hs01_00242740 predicted 2095
4 SASI_Hs01_00242741 predicted 1864
5 SASI_Hs01_00242742 predicted 592
6 SASI_Hs01_00242743 predicted 829
7 SASI_Hs01_00242744 predicted 2747
8 SASI_Hs01_00242745 predicted 3091
9 SASI_Hs01_00242746 predicted 3411
10 SASI_Hs01_00242747 predicted 2080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366866 predicted 1716
2 SASI_Hs02_00366867 predicted 1137
3 SASI_Hs01_00087559 predicted 2724
4 SASI_Hs01_00087560 predicted 1923
5 SASI_Hs01_00087561 predicted 1903
6 SASI_Hs02_00366868 predicted 2565
7 SASI_Hs01_00087565 predicted 3224
8 SASI_Hs01_00087566 predicted 1901
9 SASI_Hs01_00087567 predicted 2893
10 SASI_Hs02_00366869 predicted 1586
11 SASI_Hs01_00087562 predicted 1503
12 SASI_Hs01_00087563 predicted 307
13 SASI_Hs01_00087564 predicted 2724
14 SASI_Hs01_00087568 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268445 predicted 3396
2 SASI_Rn01_00107419 predicted 2851
3 SASI_Rn01_00107420 predicted 907
4 SASI_Rn01_00107421 predicted 1318
5 SASI_Rn02_00268446 predicted 1677
6 SASI_Rn01_00107422 predicted 2492
7 SASI_Rn01_00107423 predicted 1282
8 SASI_Rn01_00107425 predicted 2176
9 SASI_Rn01_00107426 predicted 1872
10 SASI_Rn01_00107427 predicted 472
11 SASI_Rn01_00107424 predicted 1552
12 SASI_Rn01_00107428 predicted 3541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122310 predicted 1640
2 SASI_Mm01_00122311 predicted 601
3 SASI_Mm01_00122312 predicted 802
4 SASI_Mm02_00338913 predicted 1516
5 SASI_Mm01_00122313 predicted 1566
6 SASI_Mm02_00338914 predicted 1701
7 SASI_Mm01_00122316 predicted 2097
8 SASI_Mm01_00122317 predicted 2528
9 SASI_Mm01_00122318 predicted 670
10 SASI_Mm01_00122319 predicted 895
11 SASI_Mm01_00122314 predicted 2239
12 SASI_Mm01_00122315 predicted 2437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133853
VALIDATED
MAGI3 MISSION shRNA Bacterial Glycerol Stock
membrane associated guanylate kinase, WW and PDZ domain containing 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-2471s21c1
Sequence:CCGGAGGAAGTTTGGAGACTATAAACTCGAGTTTATAGTCTCCAAACTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133853.3-4218s21c1
Sequence:CCGGCCGACATTCAGAGGAACATTTCTCGAGAAATGTTCCTCTGAATGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133853.3-4140s21c1
Sequence:CCGGTGGCGAGAAGAGTCGACTAAACTCGAGTTTAGTCGACTCTTCTCGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-3635s21c1
Sequence:CCGGTGGTGACCAGATCGTTGAAATCTCGAGATTTCAACGATCTGGTCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-804s21c1
Sequence:CCGGCAGTTTCAGAAAGGATCAATTCTCGAGAATTGATCCTTTCTGAAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-2349s21c1
Sequence:CCGGCAAGTCGTAGAAGTCCTAAAGCTCGAGCTTTAGGACTTCTACGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-3967s1c1
Sequence:CCGGGCTCTGGACAAGATCCCTATACTCGAGTATAGGGATCTTGTCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-2378s1c1
Sequence:CCGGGCTGATGAATTGATGTGTATTCTCGAGAATACACATCAATTCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-1120s1c1
Sequence:CCGGCCCTCAGTATGGAACATACTACTCGAGTAGTATGTTCCATACTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-1531s1c1
Sequence:CCGGCCTTACTTTATGCCGTGGTTACTCGAGTAACCACGGCATAAAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-2376s1c1
Sequence:CCGGCTGCTGATGAATTGATGTGTACTCGAGTACACATCAATTCATCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133853
VALIDATED
MAGI3 MISSION shRNA shRNA Plasmid DNA
membrane associated guanylate kinase, WW and PDZ domain containing 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-2471s21c1
Sequence:CCGGAGGAAGTTTGGAGACTATAAACTCGAGTTTATAGTCTCCAAACTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133853.3-4218s21c1
Sequence:CCGGCCGACATTCAGAGGAACATTTCTCGAGAAATGTTCCTCTGAATGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133853.3-4140s21c1
Sequence:CCGGTGGCGAGAAGAGTCGACTAAACTCGAGTTTAGTCGACTCTTCTCGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-3635s21c1
Sequence:CCGGTGGTGACCAGATCGTTGAAATCTCGAGATTTCAACGATCTGGTCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-804s21c1
Sequence:CCGGCAGTTTCAGAAAGGATCAATTCTCGAGAATTGATCCTTTCTGAAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-2349s21c1
Sequence:CCGGCAAGTCGTAGAAGTCCTAAAGCTCGAGCTTTAGGACTTCTACGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-3967s1c1
Sequence:CCGGGCTCTGGACAAGATCCCTATACTCGAGTATAGGGATCTTGTCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-2378s1c1
Sequence:CCGGGCTGATGAATTGATGTGTATTCTCGAGAATACACATCAATTCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-1120s1c1
Sequence:CCGGCCCTCAGTATGGAACATACTACTCGAGTAGTATGTTCCATACTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-1531s1c1
Sequence:CCGGCCTTACTTTATGCCGTGGTTACTCGAGTAACCACGGCATAAAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-2376s1c1
Sequence:CCGGCTGCTGATGAATTGATGTGTACTCGAGTACACATCAATTCATCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133853
VALIDATED
MAGI3 MISSION shRNA Lentiviral Transduction Particles
membrane associated guanylate kinase, WW and PDZ domain containing 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-2471s21c1
Sequence:CCGGAGGAAGTTTGGAGACTATAAACTCGAGTTTATAGTCTCCAAACTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133853.3-4218s21c1
Sequence:CCGGCCGACATTCAGAGGAACATTTCTCGAGAAATGTTCCTCTGAATGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133853.3-4140s21c1
Sequence:CCGGTGGCGAGAAGAGTCGACTAAACTCGAGTTTAGTCGACTCTTCTCGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-3635s21c1
Sequence:CCGGTGGTGACCAGATCGTTGAAATCTCGAGATTTCAACGATCTGGTCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-804s21c1
Sequence:CCGGCAGTTTCAGAAAGGATCAATTCTCGAGAATTGATCCTTTCTGAAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133853.3-2349s21c1
Sequence:CCGGCAAGTCGTAGAAGTCCTAAAGCTCGAGCTTTAGGACTTCTACGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-3967s1c1
Sequence:CCGGGCTCTGGACAAGATCCCTATACTCGAGTATAGGGATCTTGTCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-2378s1c1
Sequence:CCGGGCTGATGAATTGATGTGTATTCTCGAGAATACACATCAATTCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-1120s1c1
Sequence:CCGGCCCTCAGTATGGAACATACTACTCGAGTAGTATGTTCCATACTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-1531s1c1
Sequence:CCGGCCTTACTTTATGCCGTGGTTACTCGAGTAACCACGGCATAAAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133853.1-2376s1c1
Sequence:CCGGCTGCTGATGAATTGATGTGTACTCGAGTACACATCAATTCATCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152900
MAGI3 MISSION shRNA Bacterial Glycerol Stock
membrane associated guanylate kinase, WW and PDZ domain containing 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000332945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-3347s21c1
Sequence:CCGGGCCATCAAAGATGGCAGAATTCTCGAGAATTCTGCCATCTTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-1784s21c1
Sequence:CCGGGCAATGGTTCTGGAGCAGAATCTCGAGATTCTGCTCCAGAACCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-2804s21c1
Sequence:CCGGCCAGGAGTTATTCCTCATAAACTCGAGTTTATGAGGAATAACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-1231s21c1
Sequence:CCGGCCCTCAGTATGGGACATACTACTCGAGTAGTATGTCCCATACTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152900
MAGI3 MISSION shRNA shRNA Plasmid DNA
membrane associated guanylate kinase, WW and PDZ domain containing 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000332945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-3347s21c1
Sequence:CCGGGCCATCAAAGATGGCAGAATTCTCGAGAATTCTGCCATCTTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-1784s21c1
Sequence:CCGGGCAATGGTTCTGGAGCAGAATCTCGAGATTCTGCTCCAGAACCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-2804s21c1
Sequence:CCGGCCAGGAGTTATTCCTCATAAACTCGAGTTTATGAGGAATAACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-1231s21c1
Sequence:CCGGCCCTCAGTATGGGACATACTACTCGAGTAGTATGTCCCATACTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152900
MAGI3 MISSION shRNA Lentiviral Transduction Particles
membrane associated guanylate kinase, WW and PDZ domain containing 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000332945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-3347s21c1
Sequence:CCGGGCCATCAAAGATGGCAGAATTCTCGAGAATTCTGCCATCTTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-1784s21c1
Sequence:CCGGGCAATGGTTCTGGAGCAGAATCTCGAGATTCTGCTCCAGAACCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-2804s21c1
Sequence:CCGGCCAGGAGTTATTCCTCATAAACTCGAGTTTATGAGGAATAACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152900.2-1231s21c1
Sequence:CCGGCCCTCAGTATGGGACATACTACTCGAGTAGTATGTCCCATACTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020965
VALIDATED
MAGI3 MISSION shRNA Bacterial Glycerol Stock
membrane associated guanylate kinase, WW and PDZ domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020965.2-1822s1c1
Sequence:CCGGCCTCACTTTATGTCGTGGTTACTCGAGTAACCACGACATAAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-3527s1c1
Sequence:CCGGGCCATCAAAGATGGCAGAATTCTCGAGAATTCTGCCATCTTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-1964s1c1
Sequence:CCGGGCAATGGTTCTGGAGCAGAATCTCGAGATTCTGCTCCAGAACCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-1336s1c1
Sequence:CCGGCCCTCAGTATGGGACATACTACTCGAGTAGTATGTCCCATACTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-2984s1c1
Sequence:CCGGCCAGGAGTTATTCCTCATAAACTCGAGTTTATGAGGAATAACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020965
VALIDATED
MAGI3 MISSION shRNA shRNA Plasmid DNA
membrane associated guanylate kinase, WW and PDZ domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020965.2-1822s1c1
Sequence:CCGGCCTCACTTTATGTCGTGGTTACTCGAGTAACCACGACATAAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-3527s1c1
Sequence:CCGGGCCATCAAAGATGGCAGAATTCTCGAGAATTCTGCCATCTTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-1964s1c1
Sequence:CCGGGCAATGGTTCTGGAGCAGAATCTCGAGATTCTGCTCCAGAACCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-1336s1c1
Sequence:CCGGCCCTCAGTATGGGACATACTACTCGAGTAGTATGTCCCATACTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-2984s1c1
Sequence:CCGGCCAGGAGTTATTCCTCATAAACTCGAGTTTATGAGGAATAACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020965
VALIDATED
MAGI3 MISSION shRNA Lentiviral Transduction Particles
membrane associated guanylate kinase, WW and PDZ domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020965.2-1822s1c1
Sequence:CCGGCCTCACTTTATGTCGTGGTTACTCGAGTAACCACGACATAAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-3527s1c1
Sequence:CCGGGCCATCAAAGATGGCAGAATTCTCGAGAATTCTGCCATCTTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-1964s1c1
Sequence:CCGGGCAATGGTTCTGGAGCAGAATCTCGAGATTCTGCTCCAGAACCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-1336s1c1
Sequence:CCGGCCCTCAGTATGGGACATACTACTCGAGTAGTATGTCCCATACTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020965.2-2984s1c1
Sequence:CCGGCCAGGAGTTATTCCTCATAAACTCGAGTTTATGAGGAATAACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)