EMAIL THIS PAGE TO A FRIEND

MAGIX

MAGI family member, X-linked

246 Gene Product Result for
Synonyms: JM10 PDZX
UniProtKB ID: Q9H6Y5, A6XND4, A8MSX9, B7WP26, Q14C81
Gene ID:
Mouse(54634) MAGI family member, X-linked
Rat(317379) MAGI family member, X-linked
domestic guinea pig(100719655) MAGI family member, X-linked
naked mole-rat(101704360) MAGI family member, X-linked
sheep(101112793) MAGI family member, X-linked
dog(612555) MAGI family member, X-linked
domestic cat(101101195) MAGI family member, X-linked
cow(511713) MAGI family member, X-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024859 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099680 Rosetta Predictions human pricing
NM_001099681 Rosetta Predictions human pricing
NM_001099682 Rosetta Predictions human pricing
NM_024859 Rosetta Predictions human pricing
NM_001014109 Rosetta Predictions rat pricing
NM_018832 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321048 predicted 1830
2 SASI_Hs02_00321049 predicted 1899
3 SASI_Hs02_00321050 predicted 1822
4 SASI_Hs02_00321051 predicted 1977
5 SASI_Hs02_00321052 predicted 1542
6 SASI_Hs02_00321053 predicted 1862
7 SASI_Hs02_00321054 predicted 1947
8 SASI_Hs02_00321055 predicted 1697
9 SASI_Hs02_00321056 predicted 927
10 SASI_Hs02_00321057 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321058 predicted 1124
2 SASI_Hs02_00321059 predicted 1206
3 SASI_Hs02_00321060 predicted 1122
4 SASI_Hs02_00321061 predicted 1275
5 SASI_Hs02_00321062 predicted 844
6 SASI_Hs02_00321063 predicted 1163
7 SASI_Hs02_00321064 predicted 1249
8 SASI_Hs02_00321065 predicted 1003
9 SASI_Hs02_00321066 predicted 1285
10 SASI_Hs02_00321067 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321068 predicted 1111
2 SASI_Hs02_00321069 predicted 1183
3 SASI_Hs02_00321070 predicted 1107
4 SASI_Hs02_00321071 predicted 1267
5 SASI_Hs02_00321072 predicted 825
6 SASI_Hs02_00321073 predicted 1139
7 SASI_Hs02_00321074 predicted 1230
8 SASI_Hs02_00321075 predicted 988
9 SASI_Hs02_00321076 predicted 486
10 SASI_Hs02_00321077 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357439 predicted 1352
2 SASI_Hs01_00178457 predicted 1431
3 SASI_Hs01_00178460 predicted 1344
4 SASI_Hs01_00178463 predicted 1501
5 SASI_Hs01_00178464 predicted 1066
6 SASI_Hs02_00357440 predicted 1391
7 SASI_Hs01_00178459 predicted 1474
8 SASI_Hs01_00178462 predicted 1225
9 SASI_Hs01_00178455 predicted 1519
10 SASI_Hs02_00357441 predicted 255
11 SASI_Hs01_00178456 predicted 1252
12 SASI_Hs01_00178458 predicted 513
13 SASI_Hs01_00178461 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201551 predicted 1130
2 SASI_Rn01_00082690 predicted 844
3 SASI_Rn01_00082691 predicted 574
4 SASI_Rn01_00082692 predicted 300
5 SASI_Rn01_00082693 predicted 1167
6 SASI_Rn01_00082694 predicted 402
7 SASI_Rn01_00082695 predicted 907
8 SASI_Rn01_00082697 predicted 293
9 SASI_Rn01_00082698 predicted 294
10 SASI_Rn01_00082699 predicted 719
11 SASI_Rn01_00082696 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324191 predicted 1557
2 SASI_Mm02_00324192 predicted 365
3 SASI_Mm01_00124231 predicted 504
4 SASI_Mm02_00324193 predicted 280
5 SASI_Mm02_00324194 predicted 1054
6 SASI_Mm01_00124237 predicted 1082
7 SASI_Mm02_00324195 predicted 1399
8 SASI_Mm01_00124238 predicted 825
9 SASI_Mm02_00324196 predicted 1139
10 SASI_Mm02_00324197 predicted 628
11 SASI_Mm01_00124229 predicted 1083
12 SASI_Mm01_00124230 predicted 890
13 SASI_Mm01_00124232 predicted 311
14 SASI_Mm01_00124233 predicted 394
15 SASI_Mm01_00124234 predicted 352
16 SASI_Mm01_00124235 predicted 730
17 SASI_Mm01_00124236 predicted 774
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018832
MAGIX MISSION shRNA Bacterial Glycerol Stock
MAGI family member, X-linked
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018832.1-1168s1c1
Sequence:CCGGCCTTAGAGCTTTAACCTGGTTCTCGAGAACCAGGTTAAAGCTCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-305s1c1
Sequence:CCGGAGGGTGTTAGTGGTCTGGATTCTCGAGAATCCAGACCACTAACACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-530s1c1
Sequence:CCGGTCACTTTAAGTGGAGGCCGAACTCGAGTTCGGCCTCCACTTAAAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-428s1c1
Sequence:CCGGCACTTCCAGTAACCCAGAATACTCGAGTATTCTGGGTTACTGGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-357s1c1
Sequence:CCGGGCCTCATGCTACTCTTGTGAACTCGAGTTCACAAGAGTAGCATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018832.2-1090s21c1
Sequence:CCGGCACTAGGTGAGGTCCCATAAGCTCGAGCTTATGGGACCTCACCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018832.2-807s21c1
Sequence:CCGGTGGAGTCTCGCAGCACCATTTCTCGAGAAATGGTGCTGCGAGACTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018832.2-872s21c1
Sequence:CCGGAGTCCAGAGGCAGTGGCTATTCTCGAGAATAGCCACTGCCTCTGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018832
MAGIX MISSION shRNA shRNA Plasmid DNA
MAGI family member, X-linked
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018832.1-1168s1c1
Sequence:CCGGCCTTAGAGCTTTAACCTGGTTCTCGAGAACCAGGTTAAAGCTCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-305s1c1
Sequence:CCGGAGGGTGTTAGTGGTCTGGATTCTCGAGAATCCAGACCACTAACACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-530s1c1
Sequence:CCGGTCACTTTAAGTGGAGGCCGAACTCGAGTTCGGCCTCCACTTAAAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-428s1c1
Sequence:CCGGCACTTCCAGTAACCCAGAATACTCGAGTATTCTGGGTTACTGGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-357s1c1
Sequence:CCGGGCCTCATGCTACTCTTGTGAACTCGAGTTCACAAGAGTAGCATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018832.2-1090s21c1
Sequence:CCGGCACTAGGTGAGGTCCCATAAGCTCGAGCTTATGGGACCTCACCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018832.2-807s21c1
Sequence:CCGGTGGAGTCTCGCAGCACCATTTCTCGAGAAATGGTGCTGCGAGACTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018832.2-872s21c1
Sequence:CCGGAGTCCAGAGGCAGTGGCTATTCTCGAGAATAGCCACTGCCTCTGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018832
MAGIX MISSION shRNA Lentiviral Transduction Particles
MAGI family member, X-linked
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018832.1-1168s1c1
Sequence:CCGGCCTTAGAGCTTTAACCTGGTTCTCGAGAACCAGGTTAAAGCTCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-305s1c1
Sequence:CCGGAGGGTGTTAGTGGTCTGGATTCTCGAGAATCCAGACCACTAACACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-530s1c1
Sequence:CCGGTCACTTTAAGTGGAGGCCGAACTCGAGTTCGGCCTCCACTTAAAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-428s1c1
Sequence:CCGGCACTTCCAGTAACCCAGAATACTCGAGTATTCTGGGTTACTGGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018832.1-357s1c1
Sequence:CCGGGCCTCATGCTACTCTTGTGAACTCGAGTTCACAAGAGTAGCATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018832.2-1090s21c1
Sequence:CCGGCACTAGGTGAGGTCCCATAAGCTCGAGCTTATGGGACCTCACCTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018832.2-807s21c1
Sequence:CCGGTGGAGTCTCGCAGCACCATTTCTCGAGAAATGGTGCTGCGAGACTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018832.2-872s21c1
Sequence:CCGGAGTCCAGAGGCAGTGGCTATTCTCGAGAATAGCCACTGCCTCTGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024859
MAGIX MISSION shRNA Bacterial Glycerol Stock
MAGI family member, X-linked
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166575    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2502s1c1
Sequence:CCGGCCCAAGTCTGTCCTCTCAATTCTCGAGAATTGAGAGGACAGACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024859.1-269s1c1
Sequence:CCGGCATTTCTCTGTGGAGCTGGTTCTCGAGAACCAGCTCCACAGAGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024859.1-145s1c1
Sequence:CCGGCAGGGCAAACTATGTACACCTCTCGAGAGGTGTACATAGTTTGCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160608    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2291s1c1
Sequence:CCGGCCAGGAGACTAATAATAGTAACTCGAGTTACTATTATTAGTCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2481s1c1
Sequence:CCGGCGATTTAATCAAGGCCTGATTCTCGAGAATCAGGCCTTGATTAAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2513s1c1
Sequence:CCGGCCTCTCAATTTCACCTGCATTCTCGAGAATGCAGGTGAAATTGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024859.2-1517s21c1
Sequence:CCGGAGGGTCTCACACATAAATTATCTCGAGATAATTTATGTGTGAGACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024859.2-366s21c1
Sequence:CCGGATCCAGGGTAAGGCACGTAGTCTCGAGACTACGTGCCTTACCCTGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024859.2-1351s21c1
Sequence:CCGGGGTCGATCCTGCTTGAGTAATCTCGAGATTACTCAAGCAGGATCGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024859
MAGIX MISSION shRNA shRNA Plasmid DNA
MAGI family member, X-linked
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166575    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2502s1c1
Sequence:CCGGCCCAAGTCTGTCCTCTCAATTCTCGAGAATTGAGAGGACAGACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024859.1-269s1c1
Sequence:CCGGCATTTCTCTGTGGAGCTGGTTCTCGAGAACCAGCTCCACAGAGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024859.1-145s1c1
Sequence:CCGGCAGGGCAAACTATGTACACCTCTCGAGAGGTGTACATAGTTTGCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160608    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2291s1c1
Sequence:CCGGCCAGGAGACTAATAATAGTAACTCGAGTTACTATTATTAGTCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2481s1c1
Sequence:CCGGCGATTTAATCAAGGCCTGATTCTCGAGAATCAGGCCTTGATTAAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2513s1c1
Sequence:CCGGCCTCTCAATTTCACCTGCATTCTCGAGAATGCAGGTGAAATTGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024859.2-1517s21c1
Sequence:CCGGAGGGTCTCACACATAAATTATCTCGAGATAATTTATGTGTGAGACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024859.2-366s21c1
Sequence:CCGGATCCAGGGTAAGGCACGTAGTCTCGAGACTACGTGCCTTACCCTGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024859.2-1351s21c1
Sequence:CCGGGGTCGATCCTGCTTGAGTAATCTCGAGATTACTCAAGCAGGATCGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024859
MAGIX MISSION shRNA Lentiviral Transduction Particles
MAGI family member, X-linked
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166575    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2502s1c1
Sequence:CCGGCCCAAGTCTGTCCTCTCAATTCTCGAGAATTGAGAGGACAGACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024859.1-269s1c1
Sequence:CCGGCATTTCTCTGTGGAGCTGGTTCTCGAGAACCAGCTCCACAGAGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024859.1-145s1c1
Sequence:CCGGCAGGGCAAACTATGTACACCTCTCGAGAGGTGTACATAGTTTGCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160608    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2291s1c1
Sequence:CCGGCCAGGAGACTAATAATAGTAACTCGAGTTACTATTATTAGTCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2481s1c1
Sequence:CCGGCGATTTAATCAAGGCCTGATTCTCGAGAATCAGGCCTTGATTAAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024859.1-2513s1c1
Sequence:CCGGCCTCTCAATTTCACCTGCATTCTCGAGAATGCAGGTGAAATTGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024859.2-1517s21c1
Sequence:CCGGAGGGTCTCACACATAAATTATCTCGAGATAATTTATGTGTGAGACCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024859.2-366s21c1
Sequence:CCGGATCCAGGGTAAGGCACGTAGTCTCGAGACTACGTGCCTTACCCTGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024859.2-1351s21c1
Sequence:CCGGGGTCGATCCTGCTTGAGTAATCTCGAGATTACTCAAGCAGGATCGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)