EMAIL THIS PAGE TO A FRIEND

MAGOH

mago-nashi homolog, proliferation-associated (Drosophila)

59 Gene Product Result for
Synonyms: MAGOH1 MAGOHA
UniProtKB ID: P61326, B2R5A2, O35169, P50606, Q5SW69
Gene ID:
Human(4116) Summary: Drosophila that have mutations in their mago nashi (grandchildless) gene produce progeny with defects in germplasm assembly and germline development. This gene encodes the mammalian mago nashi homolog. In mammals, mRNA expression is not limited to the germ plasm, but is expressed ubiquitously in adult tissues and can be induced by serum stimulation of quiescent fibroblasts. [provided by RefSeq, Jul 2008]
Mouse(17149) mago-nashi homolog, proliferation-associated (Drosophila)
Rat(298385) mago-nashi homolog, proliferation-associated (Drosophila)
Zebrafish(100005893) mago-nashi homolog, proliferation-associated (Drosophila)
domestic cat(101093790) mago-nashi homolog, proliferation-associated (Drosophila)
dog(479562) mago-nashi homolog, proliferation-associated (Drosophila)
cow(505417) mago-nashi homolog, proliferation-associated (Drosophila)
domestic guinea pig(100727610) mago-nashi homolog, proliferation-associated (Drosophila)
naked mole-rat(101709411) mago-nashi homolog, proliferation-associated (Drosophila)
sheep(101118828) mago-nashi homolog, proliferation-associated (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002370 Rosetta Predictions human pricing
XM_001066689 Rosetta Predictions rat pricing
XM_216485 Rosetta Predictions rat pricing
NM_010760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209766 predicted 426
2 SASI_Hs01_00209767 predicted 398
3 SASI_Hs01_00209768 predicted 261
4 SASI_Hs01_00209769 predicted 432
5 SASI_Hs01_00209770 predicted 398
6 SASI_Hs01_00209771 predicted 251
7 SASI_Hs01_00209772 predicted 304
8 SASI_Hs01_00209773 predicted 269
9 SASI_Hs01_00209774 predicted 292
10 SASI_Hs02_00333705 predicted 345
11 SASI_Hs01_00209775 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318453 predicted 222
2 SASI_Rn02_00318454 predicted 251
3 SASI_Rn02_00318455 predicted 220
4 SASI_Rn02_00318456 predicted 249
5 SASI_Rn02_00318457 predicted 401
6 SASI_Rn02_00318458 predicted 228
7 SASI_Rn02_00318459 predicted 361
8 SASI_Rn02_00318460 predicted 359
9 SASI_Rn02_00318461 predicted 428
10 SASI_Rn02_00318462 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376620 predicted 225
2 SASI_Rn02_00376621 predicted 252
3 SASI_Rn02_00376622 predicted 224
4 SASI_Rn02_00376623 predicted 245
5 SASI_Rn02_00376624 predicted 401
6 SASI_Rn02_00376625 predicted 228
7 SASI_Rn02_00376626 predicted 362
8 SASI_Rn02_00376627 predicted 354
9 SASI_Rn02_00376628 predicted 428
10 SASI_Rn02_00376629 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075351 predicted 213
2 SASI_Mm01_00075352 predicted 211
3 SASI_Mm02_00319284 predicted 304
4 SASI_Mm01_00075353 predicted 308
5 SASI_Mm01_00075355 predicted 310
6 SASI_Mm01_00075356 predicted 219
7 SASI_Mm01_00075358 predicted 203
8 SASI_Mm01_00075360 predicted 215
9 SASI_Mm02_00319285 predicted 316
10 SASI_Mm02_00319286 predicted 207
11 SASI_Mm01_00075354 predicted 296
12 SASI_Mm01_00075357 predicted 297
13 SASI_Mm01_00075359 predicted 297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002370
VALIDATED
MAGOH MISSION shRNA Bacterial Glycerol Stock
mago-nashi homolog, proliferation-associated (Drosophila)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-420s21c1
Sequence:CCGGATCAATCCAAGGATCCAGAAGCTCGAGCTTCTGGATCCTTGGATTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-143s21c1
Sequence:CCGGCACGAGTTCCTGGAGTTTGAGCTCGAGCTCAAACTCCAGGAACTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-364s21c1
Sequence:CCGGTGGAGATGAACACATTTCTTTCTCGAGAAAGAAATGTGTTCATCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-296s21c1
Sequence:CCGGACCAAAGAGGATGATGCATTGCTCGAGCAATGCATCATCCTCTTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-252s21c1
Sequence:CCGGGCGTGATGGAGGAACTGAAGACTCGAGTCTTCAGTTCCTCCATCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-464s21c1
Sequence:CCGGGTCCAGGACCTGAAGTGTTTGCTCGAGCAAACACTTCAGGTCCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-520s21c1
Sequence:CCGGACCAATCTAGACTGAATATTGCTCGAGCAATATTCAGTCTAGATTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-402s21c1
Sequence:CCGGGTTCCCTTATTGATGTCAATCCTCGAGGATTGACATCAATAAGGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002370.2-175s1c1
Sequence:CCGGCGGGAAGTTAAGATATGCCAACTCGAGTTGGCATATCTTAACTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002370.2-434s1c1
Sequence:CCGGCCAGAAGGCTTACGAGTATTTCTCGAGAAATACTCGTAAGCCTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002370.2-531s1c1
Sequence:CCGGCTGAATATTGGTGTGGACATGCTCGAGCATGTCCACACCAATATTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002370.2-353s1c1
Sequence:CCGGGAAATCGTCATTGGAGATGAACTCGAGTTCATCTCCAATGACGATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002370.2-170s1c1
Sequence:CCGGCCGGACGGGAAGTTAAGATATCTCGAGATATCTTAACTTCCCGTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002370
VALIDATED
MAGOH MISSION shRNA shRNA Plasmid DNA
mago-nashi homolog, proliferation-associated (Drosophila)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-420s21c1
Sequence:CCGGATCAATCCAAGGATCCAGAAGCTCGAGCTTCTGGATCCTTGGATTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-143s21c1
Sequence:CCGGCACGAGTTCCTGGAGTTTGAGCTCGAGCTCAAACTCCAGGAACTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-364s21c1
Sequence:CCGGTGGAGATGAACACATTTCTTTCTCGAGAAAGAAATGTGTTCATCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-296s21c1
Sequence:CCGGACCAAAGAGGATGATGCATTGCTCGAGCAATGCATCATCCTCTTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-252s21c1
Sequence:CCGGGCGTGATGGAGGAACTGAAGACTCGAGTCTTCAGTTCCTCCATCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-464s21c1
Sequence:CCGGGTCCAGGACCTGAAGTGTTTGCTCGAGCAAACACTTCAGGTCCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-520s21c1
Sequence:CCGGACCAATCTAGACTGAATATTGCTCGAGCAATATTCAGTCTAGATTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-402s21c1
Sequence:CCGGGTTCCCTTATTGATGTCAATCCTCGAGGATTGACATCAATAAGGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002370.2-175s1c1
Sequence:CCGGCGGGAAGTTAAGATATGCCAACTCGAGTTGGCATATCTTAACTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002370.2-434s1c1
Sequence:CCGGCCAGAAGGCTTACGAGTATTTCTCGAGAAATACTCGTAAGCCTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002370.2-531s1c1
Sequence:CCGGCTGAATATTGGTGTGGACATGCTCGAGCATGTCCACACCAATATTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002370.2-353s1c1
Sequence:CCGGGAAATCGTCATTGGAGATGAACTCGAGTTCATCTCCAATGACGATTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002370.2-170s1c1
Sequence:CCGGCCGGACGGGAAGTTAAGATATCTCGAGATATCTTAACTTCCCGTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002370
VALIDATED
MAGOH MISSION shRNA Lentiviral Transduction Particles
mago-nashi homolog, proliferation-associated (Drosophila)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-420s21c1
Sequence:CCGGATCAATCCAAGGATCCAGAAGCTCGAGCTTCTGGATCCTTGGATTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-143s21c1
Sequence:CCGGCACGAGTTCCTGGAGTTTGAGCTCGAGCTCAAACTCCAGGAACTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-364s21c1
Sequence:CCGGTGGAGATGAACACATTTCTTTCTCGAGAAAGAAATGTGTTCATCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-296s21c1
Sequence:CCGGACCAAAGAGGATGATGCATTGCTCGAGCAATGCATCATCCTCTTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-252s21c1
Sequence:CCGGGCGTGATGGAGGAACTGAAGACTCGAGTCTTCAGTTCCTCCATCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-464s21c1
Sequence:CCGGGTCCAGGACCTGAAGTGTTTGCTCGAGCAAACACTTCAGGTCCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-520s21c1
Sequence:CCGGACCAATCTAGACTGAATATTGCTCGAGCAATATTCAGTCTAGATTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002370.2-402s21c1
Sequence:CCGGGTTCCCTTATTGATGTCAATCCTCGAGGATTGACATCAATAAGGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002370.2-175s1c1
Sequence:CCGGCGGGAAGTTAAGATATGCCAACTCGAGTTGGCATATCTTAACTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002370.2-434s1c1
Sequence:CCGGCCAGAAGGCTTACGAGTATTTCTCGAGAAATACTCGTAAGCCTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002370.2-531s1c1
Sequence:CCGGCTGAATATTGGTGTGGACATGCTCGAGCATGTCCACACCAATATTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002370.2-353s1c1
Sequence:CCGGGAAATCGTCATTGGAGATGAACTCGAGTTCATCTCCAATGACGATTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002370.2-170s1c1
Sequence:CCGGCCGGACGGGAAGTTAAGATATCTCGAGATATCTTAACTTCCCGTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010760
MAGOH MISSION shRNA Bacterial Glycerol Stock
mago-nashi homolog, proliferation-associated (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-150s21c1
Sequence:CCGGTACGCCAACAACAGCAATTACCTCGAGGTAATTGCTGTTGTTGGCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-125s21c1
Sequence:CCGGATTCCGACCTGACGGTAAATTCTCGAGAATTTACCGTCAGGTCGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-395s21c1
Sequence:CCGGTCCGGAAGGCTTGCGAGTATTCTCGAGAATACTCGCAAGCCTTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-213s21c1
Sequence:CCGGAGTGTGATGGAAGAGTTAAAGCTCGAGCTTTAACTCTTCCATCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-458s21c1
Sequence:CCGGGATTGGATTACACTTCAAGATCTCGAGATCTTGAAGTGTAATCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-312s1c1
Sequence:CCGGCTTGAAATTGTCATTGGAGATCTCGAGATCTCCAATGACAATTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-458s1c1
Sequence:CCGGGATTGGATTACACTTCAAGATCTCGAGATCTTGAAGTGTAATCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-455s1c1
Sequence:CCGGTCTGATTGGATTACACTTCAACTCGAGTTGAAGTGTAATCCAATCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-306s1c1
Sequence:CCGGCAGGAGCTTGAAATTGTCATTCTCGAGAATGACAATTTCAAGCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010760
MAGOH MISSION shRNA shRNA Plasmid DNA
mago-nashi homolog, proliferation-associated (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-150s21c1
Sequence:CCGGTACGCCAACAACAGCAATTACCTCGAGGTAATTGCTGTTGTTGGCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-125s21c1
Sequence:CCGGATTCCGACCTGACGGTAAATTCTCGAGAATTTACCGTCAGGTCGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-395s21c1
Sequence:CCGGTCCGGAAGGCTTGCGAGTATTCTCGAGAATACTCGCAAGCCTTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-213s21c1
Sequence:CCGGAGTGTGATGGAAGAGTTAAAGCTCGAGCTTTAACTCTTCCATCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-458s21c1
Sequence:CCGGGATTGGATTACACTTCAAGATCTCGAGATCTTGAAGTGTAATCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-312s1c1
Sequence:CCGGCTTGAAATTGTCATTGGAGATCTCGAGATCTCCAATGACAATTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-458s1c1
Sequence:CCGGGATTGGATTACACTTCAAGATCTCGAGATCTTGAAGTGTAATCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-455s1c1
Sequence:CCGGTCTGATTGGATTACACTTCAACTCGAGTTGAAGTGTAATCCAATCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-306s1c1
Sequence:CCGGCAGGAGCTTGAAATTGTCATTCTCGAGAATGACAATTTCAAGCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010760
MAGOH MISSION shRNA Lentiviral Transduction Particles
mago-nashi homolog, proliferation-associated (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-150s21c1
Sequence:CCGGTACGCCAACAACAGCAATTACCTCGAGGTAATTGCTGTTGTTGGCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-125s21c1
Sequence:CCGGATTCCGACCTGACGGTAAATTCTCGAGAATTTACCGTCAGGTCGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-395s21c1
Sequence:CCGGTCCGGAAGGCTTGCGAGTATTCTCGAGAATACTCGCAAGCCTTCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-213s21c1
Sequence:CCGGAGTGTGATGGAAGAGTTAAAGCTCGAGCTTTAACTCTTCCATCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010760.2-458s21c1
Sequence:CCGGGATTGGATTACACTTCAAGATCTCGAGATCTTGAAGTGTAATCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-312s1c1
Sequence:CCGGCTTGAAATTGTCATTGGAGATCTCGAGATCTCCAATGACAATTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-458s1c1
Sequence:CCGGGATTGGATTACACTTCAAGATCTCGAGATCTTGAAGTGTAATCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-455s1c1
Sequence:CCGGTCTGATTGGATTACACTTCAACTCGAGTTGAAGTGTAATCCAATCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010760.1-306s1c1
Sequence:CCGGCAGGAGCTTGAAATTGTCATTCTCGAGAATGACAATTTCAAGCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)