EMAIL THIS PAGE TO A FRIEND

MAGOHB

mago-nashi homolog B (Drosophila)

83 Gene Product Result for
Synonyms: MGN2 mago magoh
UniProtKB ID: Q96A72
Gene ID:
Mouse(66441) mago-nashi homolog B (Drosophila)
Rat(690303) mago-nashi homolog B (Drosophila)
domestic cat(101101144) mago-nashi homolog B (Drosophila)
cow(541013) mago-nashi homolog B (Drosophila)
sheep(101115866) mago-nashi homolog B (Drosophila)
naked mole-rat(101710911) mago-nashi homolog B (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018048 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018048 Rosetta Predictions human pricing
XM_001074029 Rosetta Predictions rat pricing
NM_025564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195593 predicted 373
2 SASI_Hs01_00195594 predicted 318
3 SASI_Hs01_00195595 predicted 235
4 SASI_Hs01_00195596 predicted 201
5 SASI_Hs01_00195597 predicted 206
6 SASI_Hs02_00351175 predicted 362
7 SASI_Hs01_00195598 predicted 329
8 SASI_Hs01_00195599 predicted 425
9 SASI_Hs02_00351176 predicted 114
10 SASI_Hs01_00195601 predicted 203
11 SASI_Hs01_00195600 predicted 237
12 SASI_Hs01_00195602 predicted 110
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344854 predicted 487
2 SASI_Rn02_00344855 predicted 225
3 SASI_Rn02_00344856 predicted 320
4 SASI_Rn02_00344857 predicted 246
5 SASI_Rn02_00344858 predicted 250
6 SASI_Rn02_00344859 predicted 479
7 SASI_Rn02_00344860 predicted 216
8 SASI_Rn02_00344861 predicted 212
9 SASI_Rn02_00344862 predicted 250
10 SASI_Rn02_00344863 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124607 predicted 518
2 SASI_Mm01_00124608 predicted 226
3 SASI_Mm01_00124609 predicted 486
4 SASI_Mm01_00124611 predicted 480
5 SASI_Mm01_00124612 predicted 465
6 SASI_Mm01_00124613 predicted 495
7 SASI_Mm01_00124614 predicted 231
8 SASI_Mm01_00124615 predicted 513
9 SASI_Mm01_00124616 predicted 514
10 SASI_Mm02_00328539 predicted 330
11 SASI_Mm01_00124610 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025564
VALIDATED
MAGOHB MISSION shRNA Bacterial Glycerol Stock
mago-nashi homolog B (Drosophila)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.1-235s1c1
Sequence:CCGGGCCTATGTCCACAAGAGTGTACTCGAGTACACTCTTGTGGACATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.1-177s1c1
Sequence:CCGGGAAGCTTAGATATGCCAACAACTCGAGTTGTTGGCATATCTAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.1-495s1c2
Sequence:CCGGCATTGGTCTACACTTCAAGATCTCGAGATCTTGAAGTGTAGACCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-342s1c1
Sequence:CCGGGCAGGAACTTGAAATCGTAATCTCGAGATTACGATTTCAAGTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-343s1c1
Sequence:CCGGCAGGAACTTGAAATCGTAATTCTCGAGAATTACGATTTCAAGTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-412s1c1
Sequence:CCGGGATGTAAATCAGTCAAAGGATCTCGAGATCCTTTGACTGATTTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-463s1c1
Sequence:CCGGGTACAAGACTTGAAATGCTTACTCGAGTAAGCATTTCAAGTCTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.2-257s1c1
Sequence:CCGGGAAGAACTGAAGAGAATTATTCTCGAGAATAATTCTCTTCAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-185s21c1
Sequence:CCGGTATGCCAACAACAGTAATTATCTCGAGATAATTACTGTTGTTGGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-461s21c1
Sequence:CCGGGTACAAGACTTGAAATGCTTACTCGAGTAAGCATTTCAAGTCTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-340s21c1
Sequence:CCGGGCAGGAACTTGAAATCGTAATCTCGAGATTACGATTTCAAGTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-410s21c1
Sequence:CCGGGATGTAAATCAGTCAAAGGATCTCGAGATCCTTTGACTGATTTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025564
VALIDATED
MAGOHB MISSION shRNA shRNA Plasmid DNA
mago-nashi homolog B (Drosophila)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.1-235s1c1
Sequence:CCGGGCCTATGTCCACAAGAGTGTACTCGAGTACACTCTTGTGGACATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.1-177s1c1
Sequence:CCGGGAAGCTTAGATATGCCAACAACTCGAGTTGTTGGCATATCTAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.1-495s1c2
Sequence:CCGGCATTGGTCTACACTTCAAGATCTCGAGATCTTGAAGTGTAGACCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-342s1c1
Sequence:CCGGGCAGGAACTTGAAATCGTAATCTCGAGATTACGATTTCAAGTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-343s1c1
Sequence:CCGGCAGGAACTTGAAATCGTAATTCTCGAGAATTACGATTTCAAGTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-412s1c1
Sequence:CCGGGATGTAAATCAGTCAAAGGATCTCGAGATCCTTTGACTGATTTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-463s1c1
Sequence:CCGGGTACAAGACTTGAAATGCTTACTCGAGTAAGCATTTCAAGTCTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.2-257s1c1
Sequence:CCGGGAAGAACTGAAGAGAATTATTCTCGAGAATAATTCTCTTCAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-185s21c1
Sequence:CCGGTATGCCAACAACAGTAATTATCTCGAGATAATTACTGTTGTTGGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-461s21c1
Sequence:CCGGGTACAAGACTTGAAATGCTTACTCGAGTAAGCATTTCAAGTCTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-340s21c1
Sequence:CCGGGCAGGAACTTGAAATCGTAATCTCGAGATTACGATTTCAAGTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-410s21c1
Sequence:CCGGGATGTAAATCAGTCAAAGGATCTCGAGATCCTTTGACTGATTTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025564
VALIDATED
MAGOHB MISSION shRNA Lentiviral Transduction Particles
mago-nashi homolog B (Drosophila)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.1-235s1c1
Sequence:CCGGGCCTATGTCCACAAGAGTGTACTCGAGTACACTCTTGTGGACATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.1-177s1c1
Sequence:CCGGGAAGCTTAGATATGCCAACAACTCGAGTTGTTGGCATATCTAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.1-495s1c2
Sequence:CCGGCATTGGTCTACACTTCAAGATCTCGAGATCTTGAAGTGTAGACCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-342s1c1
Sequence:CCGGGCAGGAACTTGAAATCGTAATCTCGAGATTACGATTTCAAGTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-343s1c1
Sequence:CCGGCAGGAACTTGAAATCGTAATTCTCGAGAATTACGATTTCAAGTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-412s1c1
Sequence:CCGGGATGTAAATCAGTCAAAGGATCTCGAGATCCTTTGACTGATTTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025564.1-463s1c1
Sequence:CCGGGTACAAGACTTGAAATGCTTACTCGAGTAAGCATTTCAAGTCTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025564.2-257s1c1
Sequence:CCGGGAAGAACTGAAGAGAATTATTCTCGAGAATAATTCTCTTCAGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-185s21c1
Sequence:CCGGTATGCCAACAACAGTAATTATCTCGAGATAATTACTGTTGTTGGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-461s21c1
Sequence:CCGGGTACAAGACTTGAAATGCTTACTCGAGTAAGCATTTCAAGTCTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-340s21c1
Sequence:CCGGGCAGGAACTTGAAATCGTAATCTCGAGATTACGATTTCAAGTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025564.2-410s21c1
Sequence:CCGGGATGTAAATCAGTCAAAGGATCTCGAGATCCTTTGACTGATTTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018048
VALIDATED
MAGOHB MISSION shRNA Bacterial Glycerol Stock
mago-nashi homolog B (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018048.2-929s1c1
Sequence:CCGGCCTTCATACATGATTGGATTTCTCGAGAAATCCAATCATGTATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-140s1c1
Sequence:CCGGCCGGACGGAAAGCTTAGATATCTCGAGATATCTAAGCTTTCCGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-432s1c1
Sequence:CCGGTGGTACAAGACTTGAAATGTTCTCGAGAACATTTCAAGTCTTGTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-116s1c1
Sequence:CCGGGAGTTTCTGGAGTTCGAATTTCTCGAGAAATTCGAACTCCAGAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-329s1c1
Sequence:CCGGGTAATTGGAGATGAGCACATACTCGAGTATGTGCTCATCTCCAATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018048.2-795s21c1
Sequence:CCGGCTATGTCTCTAATTCACTTTACTCGAGTAAAGTGAATTAGAGACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018048.2-860s21c1
Sequence:CCGGGATACTTTAGGTGGAACTATGCTCGAGCATAGTTCCACCTAAAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018048.2-884s21c1
Sequence:CCGGCCAGATTCCCATCCATGAAAGCTCGAGCTTTCATGGATGGGAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018048.2-380s21c1
Sequence:CCGGATTGATGTAAATCAGTCAAAGCTCGAGCTTTGACTGATTTACATCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018048
VALIDATED
MAGOHB MISSION shRNA shRNA Plasmid DNA
mago-nashi homolog B (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018048.2-929s1c1
Sequence:CCGGCCTTCATACATGATTGGATTTCTCGAGAAATCCAATCATGTATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-140s1c1
Sequence:CCGGCCGGACGGAAAGCTTAGATATCTCGAGATATCTAAGCTTTCCGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-432s1c1
Sequence:CCGGTGGTACAAGACTTGAAATGTTCTCGAGAACATTTCAAGTCTTGTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-116s1c1
Sequence:CCGGGAGTTTCTGGAGTTCGAATTTCTCGAGAAATTCGAACTCCAGAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-329s1c1
Sequence:CCGGGTAATTGGAGATGAGCACATACTCGAGTATGTGCTCATCTCCAATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018048.2-795s21c1
Sequence:CCGGCTATGTCTCTAATTCACTTTACTCGAGTAAAGTGAATTAGAGACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018048.2-860s21c1
Sequence:CCGGGATACTTTAGGTGGAACTATGCTCGAGCATAGTTCCACCTAAAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018048.2-884s21c1
Sequence:CCGGCCAGATTCCCATCCATGAAAGCTCGAGCTTTCATGGATGGGAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018048.2-380s21c1
Sequence:CCGGATTGATGTAAATCAGTCAAAGCTCGAGCTTTGACTGATTTACATCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018048
VALIDATED
MAGOHB MISSION shRNA Lentiviral Transduction Particles
mago-nashi homolog B (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018048.2-929s1c1
Sequence:CCGGCCTTCATACATGATTGGATTTCTCGAGAAATCCAATCATGTATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-140s1c1
Sequence:CCGGCCGGACGGAAAGCTTAGATATCTCGAGATATCTAAGCTTTCCGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-432s1c1
Sequence:CCGGTGGTACAAGACTTGAAATGTTCTCGAGAACATTTCAAGTCTTGTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-116s1c1
Sequence:CCGGGAGTTTCTGGAGTTCGAATTTCTCGAGAAATTCGAACTCCAGAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018048.2-329s1c1
Sequence:CCGGGTAATTGGAGATGAGCACATACTCGAGTATGTGCTCATCTCCAATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018048.2-795s21c1
Sequence:CCGGCTATGTCTCTAATTCACTTTACTCGAGTAAAGTGAATTAGAGACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018048.2-860s21c1
Sequence:CCGGGATACTTTAGGTGGAACTATGCTCGAGCATAGTTCCACCTAAAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018048.2-884s21c1
Sequence:CCGGCCAGATTCCCATCCATGAAAGCTCGAGCTTTCATGGATGGGAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018048.2-380s21c1
Sequence:CCGGATTGATGTAAATCAGTCAAAGCTCGAGCTTTGACTGATTTACATCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)