EMAIL THIS PAGE TO A FRIEND

MAGT1

magnesium transporter 1

185 Gene Product Result for
Synonyms: IAP MRX95 OST3B PRO0756 XMEN bA217H1.1
UniProtKB ID: Q9H0U3, B2RAR4, D3DTE3, Q53G00, Q8NBN6
Gene ID:
Human(84061) Summary: This gene encodes a magnesium cation transporter protein that localizes to the cell membrane. This protein also associates with N-oligosaccharyl transferase and therefore may have a role in N-glycosylation. Mutations in this gene cause mental retardation X-linked type 95 (MRX95). This gene may have multiple in-frame translation initiation sites, one of which would encode a shorter protein with an N-terminus containing a signal peptide at amino acids 1-29. [provided by RefSeq, Jan 2010]
Mouse(67075) magnesium transporter 1
Rat(116967) magnesium transporter 1
domestic guinea pig(100714677) magnesium transporter 1
naked mole-rat(101705381) magnesium transporter 1
sheep(101117139) magnesium transporter 1
Zebrafish(324944) magnesium transporter 1
chicken(422332) magnesium transporter 1
domestic cat(101085275) magnesium transporter 1
cow(100301169) magnesium transporter 1
Horse(100071782) magnesium transporter 1
dog(491975) magnesium transporter 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032121 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032121 Rosetta Predictions human pricing
NM_053946 Rosetta Predictions rat pricing
NM_025952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170453 predicted 639
2 SASI_Hs01_00170454 predicted 587
3 SASI_Hs01_00170455 predicted 415
4 SASI_Hs01_00170456 predicted 604
5 SASI_Hs01_00170457 predicted 344
6 SASI_Hs01_00170458 predicted 917
7 SASI_Hs01_00170459 predicted 540
8 SASI_Hs01_00170460 predicted 265
9 SASI_Hs01_00170462 predicted 712
10 SASI_Hs02_00359326 predicted 536
11 SASI_Hs01_00170461 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094947 predicted 651
2 SASI_Rn01_00094948 predicted 323
3 SASI_Rn01_00094949 predicted 742
4 SASI_Rn01_00094950 predicted 600
5 SASI_Rn01_00094951 predicted 664
6 SASI_Rn01_00094952 predicted 421
7 SASI_Rn01_00094953 predicted 656
8 SASI_Rn01_00094954 predicted 375
9 SASI_Rn02_00266904 predicted 555
10 SASI_Rn01_00094956 predicted 670
11 SASI_Rn01_00094955 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052589 predicted 440
2 SASI_Mm01_00052590 predicted 300
3 SASI_Mm01_00052591 predicted 713
4 SASI_Mm01_00052592 predicted 341
5 SASI_Mm01_00052593 predicted 539
6 SASI_Mm01_00052594 predicted 412
7 SASI_Mm01_00052595 predicted 390
8 SASI_Mm01_00052596 predicted 714
9 SASI_Mm01_00052597 predicted 533
10 SASI_Mm02_00329354 predicted 1045
11 SASI_Mm01_00052598 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032121
VALIDATED
MAGT1 MISSION shRNA Bacterial Glycerol Stock
magnesium transporter 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032121.5-1634s21c1
Sequence:CCGGTGTATACTTTACGCATCTTTCCTCGAGGAAAGATGCGTAAAGTATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032121.5-670s21c1
Sequence:CCGGCCGACAGAACTGATGTCAATACTCGAGTATTGACATCAGTTCTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032121.5-1026s21c1
Sequence:CCGGGCTACCTCTGACATGGATATTCTCGAGAATATCCATGTCAGAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-223s1c1
Sequence:CCGGCCACCGAGAAATTACTCCGTTCTCGAGAACGGAGTAATTTCTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-889s1c1
Sequence:CCGGGCTACCTCTGACATGGATATTCTCGAGAATATCCATGTCAGAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-533s1c1
Sequence:CCGGCCGACAGAACTGATGTCAATACTCGAGTATTGACATCAGTTCTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-745s1c1
Sequence:CCGGCCACCATATGCCCATAAGAATCTCGAGATTCTTATGGGCATATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-150s1c1
Sequence:CCGGGCTGATGGAATGGACTAACAACTCGAGTTGTTAGTCCATTCCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032121.5-362s21c1
Sequence:CCGGACCGAGAAATTACTCCGTTATCTCGAGATAACGGAGTAATTTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032121.5-882s21c1
Sequence:CCGGCCACCATATGCCCATAAGAATCTCGAGATTCTTATGGGCATATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032121
VALIDATED
MAGT1 MISSION shRNA shRNA Plasmid DNA
magnesium transporter 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032121.5-1634s21c1
Sequence:CCGGTGTATACTTTACGCATCTTTCCTCGAGGAAAGATGCGTAAAGTATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032121.5-670s21c1
Sequence:CCGGCCGACAGAACTGATGTCAATACTCGAGTATTGACATCAGTTCTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032121.5-1026s21c1
Sequence:CCGGGCTACCTCTGACATGGATATTCTCGAGAATATCCATGTCAGAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-223s1c1
Sequence:CCGGCCACCGAGAAATTACTCCGTTCTCGAGAACGGAGTAATTTCTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-889s1c1
Sequence:CCGGGCTACCTCTGACATGGATATTCTCGAGAATATCCATGTCAGAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-533s1c1
Sequence:CCGGCCGACAGAACTGATGTCAATACTCGAGTATTGACATCAGTTCTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-745s1c1
Sequence:CCGGCCACCATATGCCCATAAGAATCTCGAGATTCTTATGGGCATATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-150s1c1
Sequence:CCGGGCTGATGGAATGGACTAACAACTCGAGTTGTTAGTCCATTCCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032121.5-362s21c1
Sequence:CCGGACCGAGAAATTACTCCGTTATCTCGAGATAACGGAGTAATTTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032121.5-882s21c1
Sequence:CCGGCCACCATATGCCCATAAGAATCTCGAGATTCTTATGGGCATATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032121
VALIDATED
MAGT1 MISSION shRNA Lentiviral Transduction Particles
magnesium transporter 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032121.5-1634s21c1
Sequence:CCGGTGTATACTTTACGCATCTTTCCTCGAGGAAAGATGCGTAAAGTATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032121.5-670s21c1
Sequence:CCGGCCGACAGAACTGATGTCAATACTCGAGTATTGACATCAGTTCTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032121.5-1026s21c1
Sequence:CCGGGCTACCTCTGACATGGATATTCTCGAGAATATCCATGTCAGAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-223s1c1
Sequence:CCGGCCACCGAGAAATTACTCCGTTCTCGAGAACGGAGTAATTTCTCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-889s1c1
Sequence:CCGGGCTACCTCTGACATGGATATTCTCGAGAATATCCATGTCAGAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-533s1c1
Sequence:CCGGCCGACAGAACTGATGTCAATACTCGAGTATTGACATCAGTTCTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-745s1c1
Sequence:CCGGCCACCATATGCCCATAAGAATCTCGAGATTCTTATGGGCATATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032121.3-150s1c1
Sequence:CCGGGCTGATGGAATGGACTAACAACTCGAGTTGTTAGTCCATTCCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032121.5-362s21c1
Sequence:CCGGACCGAGAAATTACTCCGTTATCTCGAGATAACGGAGTAATTTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032121.5-882s21c1
Sequence:CCGGCCACCATATGCCCATAAGAATCTCGAGATTCTTATGGGCATATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025952
VALIDATED
MAGT1 MISSION shRNA Bacterial Glycerol Stock
magnesium transporter 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-225s21c1
Sequence:CCGGCCACCGAGAAATTACTCAGTTCTCGAGAACTGAGTAATTTCTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-974s21c1
Sequence:CCGGGCTCTCTATCTTTCGATCAAACTCGAGTTTGATCGAAAGATAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025952.3-1159s21c1
Sequence:CCGGCCTGTGTCTTTCCACCTGAAACTCGAGTTTCAGGTGGAAAGACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-261s21c1
Sequence:CCGGGCTCTCCAACTTCATAGACAACTCGAGTTGTCTATGAAGTTGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-215s1c1
Sequence:CCGGCCACCGAGAAATTACTCAGTTCTCGAGAACTGAGTAATTTCTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-429s21c1
Sequence:CCGGGCTCCAACTTTCATCAACTTTCTCGAGAAAGTTGATGAAAGTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-419s1c1
Sequence:CCGGGCTCCAACTTTCATCAACTTTCTCGAGAAAGTTGATGAAAGTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-964s1c1
Sequence:CCGGGCTCTCTATCTTTCGATCAAACTCGAGTTTGATCGAAAGATAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-1558s1c1
Sequence:CCGGCCTGTGTCTTTCCACCTGAAACTCGAGTTTCAGGTGGAAAGACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-251s1c1
Sequence:CCGGGCTCTCCAACTTCATAGACAACTCGAGTTGTCTATGAAGTTGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025952
VALIDATED
MAGT1 MISSION shRNA shRNA Plasmid DNA
magnesium transporter 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-225s21c1
Sequence:CCGGCCACCGAGAAATTACTCAGTTCTCGAGAACTGAGTAATTTCTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-974s21c1
Sequence:CCGGGCTCTCTATCTTTCGATCAAACTCGAGTTTGATCGAAAGATAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025952.3-1159s21c1
Sequence:CCGGCCTGTGTCTTTCCACCTGAAACTCGAGTTTCAGGTGGAAAGACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-261s21c1
Sequence:CCGGGCTCTCCAACTTCATAGACAACTCGAGTTGTCTATGAAGTTGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-215s1c1
Sequence:CCGGCCACCGAGAAATTACTCAGTTCTCGAGAACTGAGTAATTTCTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-429s21c1
Sequence:CCGGGCTCCAACTTTCATCAACTTTCTCGAGAAAGTTGATGAAAGTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-419s1c1
Sequence:CCGGGCTCCAACTTTCATCAACTTTCTCGAGAAAGTTGATGAAAGTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-964s1c1
Sequence:CCGGGCTCTCTATCTTTCGATCAAACTCGAGTTTGATCGAAAGATAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-1558s1c1
Sequence:CCGGCCTGTGTCTTTCCACCTGAAACTCGAGTTTCAGGTGGAAAGACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-251s1c1
Sequence:CCGGGCTCTCCAACTTCATAGACAACTCGAGTTGTCTATGAAGTTGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025952
VALIDATED
MAGT1 MISSION shRNA Lentiviral Transduction Particles
magnesium transporter 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-225s21c1
Sequence:CCGGCCACCGAGAAATTACTCAGTTCTCGAGAACTGAGTAATTTCTCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-974s21c1
Sequence:CCGGGCTCTCTATCTTTCGATCAAACTCGAGTTTGATCGAAAGATAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025952.3-1159s21c1
Sequence:CCGGCCTGTGTCTTTCCACCTGAAACTCGAGTTTCAGGTGGAAAGACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-261s21c1
Sequence:CCGGGCTCTCCAACTTCATAGACAACTCGAGTTGTCTATGAAGTTGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-215s1c1
Sequence:CCGGCCACCGAGAAATTACTCAGTTCTCGAGAACTGAGTAATTTCTCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025952.3-429s21c1
Sequence:CCGGGCTCCAACTTTCATCAACTTTCTCGAGAAAGTTGATGAAAGTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-419s1c1
Sequence:CCGGGCTCCAACTTTCATCAACTTTCTCGAGAAAGTTGATGAAAGTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-964s1c1
Sequence:CCGGGCTCTCTATCTTTCGATCAAACTCGAGTTTGATCGAAAGATAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-1558s1c1
Sequence:CCGGCCTGTGTCTTTCCACCTGAAACTCGAGTTTCAGGTGGAAAGACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025952.2-251s1c1
Sequence:CCGGGCTCTCCAACTTCATAGACAACTCGAGTTGTCTATGAAGTTGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)