EMAIL THIS PAGE TO A FRIEND

MAK16

MAK16 homolog (S. cerevisiae)

66 Gene Product Result for
Synonyms: MAK16L RBM13
UniProtKB ID: Q9BXY0, B2RB44, Q5U5T1, Q86UC4, Q96SY6
Gene ID:
Mouse(67920) MAK16 homolog (S. cerevisiae)
Rat(306526) MAK16 homolog (S. cerevisiae)
Zebrafish(192312) MAK16 homolog (S. cerevisiae)
cow(504683) MAK16 homolog (S. cerevisiae)
domestic cat(101097636) MAK16 homolog (S. cerevisiae)
dog(475593) MAK16 homolog (S. cerevisiae)
chicken(426924) MAK16 homolog (S. cerevisiae)
domestic guinea pig(100721445) MAK16 homolog (S. cerevisiae)
naked mole-rat(101719172) MAK16 homolog (S. cerevisiae)
Goat(100861095) MAK16 homolog (S. cerevisiae)
sheep(101108365) MAK16 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032509 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032509 Rosetta Predictions human pricing
NM_001014002 Rosetta Predictions rat pricing
NM_026453 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108849 predicted 201
2 SASI_Hs01_00108846 predicted 336
3 SASI_Hs02_00359998 predicted 1293
4 SASI_Hs01_00108847 predicted 347
5 SASI_Hs01_00108848 predicted 399
6 SASI_Hs02_00359999 predicted 1337
7 SASI_Hs02_00360000 predicted 1292
8 SASI_Hs01_00108850 predicted 118
9 SASI_Hs01_00108851 predicted 182
10 SASI_Hs01_00108852 predicted 899
11 SASI_Hs01_00108853 predicted 518
12 SASI_Hs01_00108854 predicted 266
13 SASI_Hs01_00108855 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201368 predicted 418
2 SASI_Rn02_00201369 predicted 689
3 SASI_Rn01_00060666 predicted 366
4 SASI_Rn01_00060667 predicted 733
5 SASI_Rn01_00060670 predicted 432
6 SASI_Rn01_00060671 predicted 935
7 SASI_Rn01_00060673 predicted 345
8 SASI_Rn01_00060674 predicted 981
9 SASI_Rn02_00201370 predicted 791
10 SASI_Rn02_00201371 predicted 243
11 SASI_Rn01_00060665 predicted 844
12 SASI_Rn01_00060668 predicted 444
13 SASI_Rn01_00060669 predicted 304
14 SASI_Rn01_00060672 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330293 predicted 1014
2 SASI_Mm02_00330294 predicted 370
3 SASI_Mm02_00330295 predicted 365
4 SASI_Mm02_00330296 predicted 1096
5 SASI_Mm02_00330297 predicted 925
6 SASI_Mm02_00330298 predicted 1000
7 SASI_Mm02_00330299 predicted 1164
8 SASI_Mm02_00330300 predicted 243
9 SASI_Mm02_00330301 predicted 979
10 SASI_Mm02_00330302 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032509
VALIDATED
MAK16 MISSION shRNA Bacterial Glycerol Stock
MAK16 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032509.3-275s21c1
Sequence:CCGGGAACGGGTCCGGCTTAGTAAACTCGAGTTTACTAAGCCGGACCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032509.3-584s21c1
Sequence:CCGGCCCATTCATGCCTTCGACAAACTCGAGTTTGTCGAAGGCATGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032509.2-552s1c1
Sequence:CCGGCCCATTCATGCCTTCGACAAACTCGAGTTTGTCGAAGGCATGAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032509.2-2002s1c1
Sequence:CCGGGCTACCTTCAATCTTCAACTACTCGAGTAGTTGAAGATTGAAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032509.2-148s1c1
Sequence:CCGGCAAATAGTCAGTATGCCACTACTCGAGTAGTGGCATACTGACTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032509.2-846s1c1
Sequence:CCGGCGAGCCTATGTGGAAATAGAACTCGAGTTCTATTTCCACATAGGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032509.2-681s1c1
Sequence:CCGGGAGGTAGATGAGAGTGACATACTCGAGTATGTCACTCTCATCTACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_032509.3-713s21c1
Sequence:CCGGGAGGTAGATGAGAGTGACATACTCGAGTATGTCACTCTCATCTACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032509.3-357s21c1
Sequence:CCGGGACACAAATGTAAGCAGAGATCTCGAGATCTCTGCTTACATTTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032509.2-325s1c1
Sequence:CCGGGACACAAATGTAAGCAGAGATCTCGAGATCTCTGCTTACATTTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032509
VALIDATED
MAK16 MISSION shRNA shRNA Plasmid DNA
MAK16 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032509.3-275s21c1
Sequence:CCGGGAACGGGTCCGGCTTAGTAAACTCGAGTTTACTAAGCCGGACCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032509.3-584s21c1
Sequence:CCGGCCCATTCATGCCTTCGACAAACTCGAGTTTGTCGAAGGCATGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032509.2-552s1c1
Sequence:CCGGCCCATTCATGCCTTCGACAAACTCGAGTTTGTCGAAGGCATGAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032509.2-2002s1c1
Sequence:CCGGGCTACCTTCAATCTTCAACTACTCGAGTAGTTGAAGATTGAAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032509.2-148s1c1
Sequence:CCGGCAAATAGTCAGTATGCCACTACTCGAGTAGTGGCATACTGACTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032509.2-846s1c1
Sequence:CCGGCGAGCCTATGTGGAAATAGAACTCGAGTTCTATTTCCACATAGGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032509.2-681s1c1
Sequence:CCGGGAGGTAGATGAGAGTGACATACTCGAGTATGTCACTCTCATCTACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_032509.3-713s21c1
Sequence:CCGGGAGGTAGATGAGAGTGACATACTCGAGTATGTCACTCTCATCTACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032509.3-357s21c1
Sequence:CCGGGACACAAATGTAAGCAGAGATCTCGAGATCTCTGCTTACATTTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032509.2-325s1c1
Sequence:CCGGGACACAAATGTAAGCAGAGATCTCGAGATCTCTGCTTACATTTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032509
VALIDATED
MAK16 MISSION shRNA Lentiviral Transduction Particles
MAK16 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032509.3-275s21c1
Sequence:CCGGGAACGGGTCCGGCTTAGTAAACTCGAGTTTACTAAGCCGGACCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032509.3-584s21c1
Sequence:CCGGCCCATTCATGCCTTCGACAAACTCGAGTTTGTCGAAGGCATGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032509.2-552s1c1
Sequence:CCGGCCCATTCATGCCTTCGACAAACTCGAGTTTGTCGAAGGCATGAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032509.2-2002s1c1
Sequence:CCGGGCTACCTTCAATCTTCAACTACTCGAGTAGTTGAAGATTGAAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032509.2-148s1c1
Sequence:CCGGCAAATAGTCAGTATGCCACTACTCGAGTAGTGGCATACTGACTATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032509.2-846s1c1
Sequence:CCGGCGAGCCTATGTGGAAATAGAACTCGAGTTCTATTTCCACATAGGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032509.2-681s1c1
Sequence:CCGGGAGGTAGATGAGAGTGACATACTCGAGTATGTCACTCTCATCTACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_032509.3-713s21c1
Sequence:CCGGGAGGTAGATGAGAGTGACATACTCGAGTATGTCACTCTCATCTACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032509.3-357s21c1
Sequence:CCGGGACACAAATGTAAGCAGAGATCTCGAGATCTCTGCTTACATTTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032509.2-325s1c1
Sequence:CCGGGACACAAATGTAAGCAGAGATCTCGAGATCTCTGCTTACATTTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026453
VALIDATED
MAK16 MISSION shRNA Bacterial Glycerol Stock
MAK16 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026453.3-178s21c1
Sequence:CCGGCCTCTGGCAAATAGTCAGTATCTCGAGATACTGACTATTTGCCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-452s1c1
Sequence:CCGGCCTTTGAGTAAGAAGGTTGAACTCGAGTTCAACCTTCTTACTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-1023s1c1
Sequence:CCGGGCCGAAATCTGGAGTGAGTATCTCGAGATACTCACTCCAGATTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-200s1c1
Sequence:CCGGGCTACCATTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTAATGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-785s1c1
Sequence:CCGGCAGGATGATGAATCCTCCAATCTCGAGATTGGAGGATTCATCATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026453.3-1022s21c1
Sequence:CCGGGCCGAAATCTGGAGTGAGTATCTCGAGATACTCACTCCAGATTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026453.3-280s21c1
Sequence:CCGGGAACGGGTCCGGCTTAGTAAACTCGAGTTTACTAAGCCGGACCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026453.3-1132s1c1
Sequence:CCGGGAATGGCACTGGCTGTAAATACTCGAGTATTTACAGCCAGTGCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026453.1-354s1c1
Sequence:CCGGGCTTTATCAGACACAAATGTACTCGAGTACATTTGTGTCTGATAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-179s1c1
Sequence:CCGGCCTCTGGCAAATAGTCAGTATCTCGAGATACTGACTATTTGCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026453.3-784s21c1
Sequence:CCGGCAGGATGATGAATCCTCCAATCTCGAGATTGGAGGATTCATCATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026453.3-199s21c1
Sequence:CCGGGCTACCATTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTAATGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026453
VALIDATED
MAK16 MISSION shRNA shRNA Plasmid DNA
MAK16 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026453.3-178s21c1
Sequence:CCGGCCTCTGGCAAATAGTCAGTATCTCGAGATACTGACTATTTGCCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-452s1c1
Sequence:CCGGCCTTTGAGTAAGAAGGTTGAACTCGAGTTCAACCTTCTTACTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-1023s1c1
Sequence:CCGGGCCGAAATCTGGAGTGAGTATCTCGAGATACTCACTCCAGATTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-200s1c1
Sequence:CCGGGCTACCATTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTAATGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-785s1c1
Sequence:CCGGCAGGATGATGAATCCTCCAATCTCGAGATTGGAGGATTCATCATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026453.3-1022s21c1
Sequence:CCGGGCCGAAATCTGGAGTGAGTATCTCGAGATACTCACTCCAGATTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026453.3-280s21c1
Sequence:CCGGGAACGGGTCCGGCTTAGTAAACTCGAGTTTACTAAGCCGGACCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026453.3-1132s1c1
Sequence:CCGGGAATGGCACTGGCTGTAAATACTCGAGTATTTACAGCCAGTGCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026453.1-354s1c1
Sequence:CCGGGCTTTATCAGACACAAATGTACTCGAGTACATTTGTGTCTGATAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-179s1c1
Sequence:CCGGCCTCTGGCAAATAGTCAGTATCTCGAGATACTGACTATTTGCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026453.3-784s21c1
Sequence:CCGGCAGGATGATGAATCCTCCAATCTCGAGATTGGAGGATTCATCATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026453.3-199s21c1
Sequence:CCGGGCTACCATTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTAATGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026453
VALIDATED
MAK16 MISSION shRNA Lentiviral Transduction Particles
MAK16 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026453.3-178s21c1
Sequence:CCGGCCTCTGGCAAATAGTCAGTATCTCGAGATACTGACTATTTGCCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-452s1c1
Sequence:CCGGCCTTTGAGTAAGAAGGTTGAACTCGAGTTCAACCTTCTTACTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-1023s1c1
Sequence:CCGGGCCGAAATCTGGAGTGAGTATCTCGAGATACTCACTCCAGATTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-200s1c1
Sequence:CCGGGCTACCATTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTAATGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-785s1c1
Sequence:CCGGCAGGATGATGAATCCTCCAATCTCGAGATTGGAGGATTCATCATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026453.3-1022s21c1
Sequence:CCGGGCCGAAATCTGGAGTGAGTATCTCGAGATACTCACTCCAGATTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026453.3-280s21c1
Sequence:CCGGGAACGGGTCCGGCTTAGTAAACTCGAGTTTACTAAGCCGGACCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026453.3-1132s1c1
Sequence:CCGGGAATGGCACTGGCTGTAAATACTCGAGTATTTACAGCCAGTGCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026453.1-354s1c1
Sequence:CCGGGCTTTATCAGACACAAATGTACTCGAGTACATTTGTGTCTGATAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026453.1-179s1c1
Sequence:CCGGCCTCTGGCAAATAGTCAGTATCTCGAGATACTGACTATTTGCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026453.3-784s21c1
Sequence:CCGGCAGGATGATGAATCCTCCAATCTCGAGATTGGAGGATTCATCATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026453.3-199s21c1
Sequence:CCGGGCTACCATTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTAATGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)