EMAIL THIS PAGE TO A FRIEND

MAK

male germ cell-associated kinase

64 Gene Product Result for
Synonyms: RP62 dJ417M14.2
UniProtKB ID: P20794, F1T0K6, G1FL29, Q547D0, Q9NUH7
Gene ID:
Human(4117) Summary: The product of this gene is a serine/threonine protein kinase related to kinases involved in cell cycle regulation. It is expressed almost exclusively in the testis, primarily in germ cells. Studies of the mouse and rat homologs have localized the kinase to the chromosomes during meiosis in spermatogenesis, specifically to the synaptonemal complex that exists while homologous chromosomes are paired. There is, however, a study of the mouse homolog that has identified high levels of expression in developing sensory epithelia so its function may be more generalized. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(17152) male germ cell-associated kinase
Rat(25677) male germ cell-associated kinase
Zebrafish(335339) male germ cell-associated kinase
domestic cat(101093856) male germ cell-associated kinase
cow(536048) male germ cell-associated kinase
Horse(100051342) male germ cell-associated kinase
dog(478721) male germ cell-associated kinase
chicken(420859) male germ cell-associated kinase
sheep(101105786) male germ cell-associated kinase
naked mole-rat(101700035) male germ cell-associated kinase
Domestic Rabbit(100357745) male germ cell-associated kinase
domestic guinea pig(100714757) male germ cell-associated kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005906 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061381 MISSION® esiRNA esiRNA human MAK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005906 Rosetta Predictions human pricing
NM_013136 Rosetta Predictions rat pricing
NM_008547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113718 predicted 1084
2 SASI_Hs01_00113719 predicted 1915
3 SASI_Hs01_00113720 predicted 1841
4 SASI_Hs01_00113721 predicted 1833
5 SASI_Hs02_00340518 predicted 1203
6 SASI_Hs01_00113723 predicted 1165
7 SASI_Hs01_00113724 predicted 392
8 SASI_Hs01_00113725 predicted 502
9 SASI_Hs02_00340519 predicted 1101
10 SASI_Hs01_00113726 predicted 2122
11 SASI_Hs01_00113722 predicted 1271
12 SASI_Hs01_00113727 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260935 predicted 600
2 SASI_Rn01_00107227 predicted 1729
3 SASI_Rn01_00107228 predicted 345
4 SASI_Rn01_00107229 predicted 1661
5 SASI_Rn01_00107231 predicted 1001
6 SASI_Rn01_00107232 predicted 1268
7 SASI_Rn02_00260936 predicted 1189
8 SASI_Rn01_00107233 predicted 515
9 SASI_Rn01_00107235 predicted 840
10 SASI_Rn01_00107236 predicted 1091
11 SASI_Rn01_00107230 predicted 1015
12 SASI_Rn01_00107234 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131959 predicted 778
2 SASI_Mm01_00131960 predicted 1250
3 SASI_Mm01_00131961 predicted 1328
4 SASI_Mm01_00131962 predicted 1827
5 SASI_Mm01_00131963 predicted 1892
6 SASI_Mm01_00131965 predicted 330
7 SASI_Mm01_00131966 predicted 652
8 SASI_Mm01_00131967 predicted 494
9 SASI_Mm01_00131968 predicted 1055
10 SASI_Mm02_00314143 predicted 1687
11 SASI_Mm01_00131964 predicted 1728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008547
MAK MISSION shRNA Bacterial Glycerol Stock
male germ cell-associated kinase
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-1788s1c1
Sequence:CCGGCCTTTCCTTCAAGAGGAGTAACTCGAGTTACTCCTCTTGAAGGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-1711s1c1
Sequence:CCGGGCTGGAGGCAAGGATATAAATCTCGAGATTTATATCCTTGCCTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-1444s1c1
Sequence:CCGGGACGACATTGAGGACGACTTACTCGAGTAAGTCGTCCTCAATGTCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-366s1c1
Sequence:CCGGGCGAGAAGTTAAGTCCCTGAACTCGAGTTCAGGGACTTAACTTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008547.2-839s21c1
Sequence:CCGGGTGAAGTTGATGAGATCTTTACTCGAGTAAAGATCTCATCAACTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008547.2-2063s21c1
Sequence:CCGGCAGACTGGGTGGCTAAGTATGCTCGAGCATACTTAGCCACCCAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008547
MAK MISSION shRNA shRNA Plasmid DNA
male germ cell-associated kinase
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-1788s1c1
Sequence:CCGGCCTTTCCTTCAAGAGGAGTAACTCGAGTTACTCCTCTTGAAGGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-1711s1c1
Sequence:CCGGGCTGGAGGCAAGGATATAAATCTCGAGATTTATATCCTTGCCTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-1444s1c1
Sequence:CCGGGACGACATTGAGGACGACTTACTCGAGTAAGTCGTCCTCAATGTCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-366s1c1
Sequence:CCGGGCGAGAAGTTAAGTCCCTGAACTCGAGTTCAGGGACTTAACTTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008547.2-839s21c1
Sequence:CCGGGTGAAGTTGATGAGATCTTTACTCGAGTAAAGATCTCATCAACTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008547.2-2063s21c1
Sequence:CCGGCAGACTGGGTGGCTAAGTATGCTCGAGCATACTTAGCCACCCAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008547
MAK MISSION shRNA Lentiviral Transduction Particles
male germ cell-associated kinase
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-1788s1c1
Sequence:CCGGCCTTTCCTTCAAGAGGAGTAACTCGAGTTACTCCTCTTGAAGGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-1711s1c1
Sequence:CCGGGCTGGAGGCAAGGATATAAATCTCGAGATTTATATCCTTGCCTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-1444s1c1
Sequence:CCGGGACGACATTGAGGACGACTTACTCGAGTAAGTCGTCCTCAATGTCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008547.1-366s1c1
Sequence:CCGGGCGAGAAGTTAAGTCCCTGAACTCGAGTTCAGGGACTTAACTTCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008547.2-839s21c1
Sequence:CCGGGTGAAGTTGATGAGATCTTTACTCGAGTAAAGATCTCATCAACTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008547.2-2063s21c1
Sequence:CCGGCAGACTGGGTGGCTAAGTATGCTCGAGCATACTTAGCCACCCAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005906
MAK MISSION shRNA Bacterial Glycerol Stock
male germ cell-associated kinase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-982s1c1
Sequence:CCGGCAATGCCAGTAATGAAGCTATCTCGAGATAGCTTCATTACTGGCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-1107s1c1
Sequence:CCGGCGTCAAATCATCTGGAATCAACTCGAGTTGATTCCAGATGATTTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-806s1c1
Sequence:CCGGCTCTATATGTTAAGGCCACTTCTCGAGAAGTGGCCTTAACATATAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-1912s1c1
Sequence:CCGGGATCCACTTAGCACCTCTCAACTCGAGTTGAGAGGTGCTAAGTGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005906.x-2562s1c1
Sequence:CCGGGCTGTGGTTCTTATTTGACTACTCGAGTAGTCAAATAAGAACCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005906.3-1169s1c1
Sequence:CCGGCCATCTTTAGTTGAGGTAGAGCTCGAGCTCTACCTCAACTAAAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005906
MAK MISSION shRNA shRNA Plasmid DNA
male germ cell-associated kinase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-982s1c1
Sequence:CCGGCAATGCCAGTAATGAAGCTATCTCGAGATAGCTTCATTACTGGCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-1107s1c1
Sequence:CCGGCGTCAAATCATCTGGAATCAACTCGAGTTGATTCCAGATGATTTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-806s1c1
Sequence:CCGGCTCTATATGTTAAGGCCACTTCTCGAGAAGTGGCCTTAACATATAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-1912s1c1
Sequence:CCGGGATCCACTTAGCACCTCTCAACTCGAGTTGAGAGGTGCTAAGTGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005906.x-2562s1c1
Sequence:CCGGGCTGTGGTTCTTATTTGACTACTCGAGTAGTCAAATAAGAACCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005906.3-1169s1c1
Sequence:CCGGCCATCTTTAGTTGAGGTAGAGCTCGAGCTCTACCTCAACTAAAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005906
MAK MISSION shRNA Lentiviral Transduction Particles
male germ cell-associated kinase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-982s1c1
Sequence:CCGGCAATGCCAGTAATGAAGCTATCTCGAGATAGCTTCATTACTGGCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-1107s1c1
Sequence:CCGGCGTCAAATCATCTGGAATCAACTCGAGTTGATTCCAGATGATTTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-806s1c1
Sequence:CCGGCTCTATATGTTAAGGCCACTTCTCGAGAAGTGGCCTTAACATATAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005906.x-1912s1c1
Sequence:CCGGGATCCACTTAGCACCTCTCAACTCGAGTTGAGAGGTGCTAAGTGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005906.x-2562s1c1
Sequence:CCGGGCTGTGGTTCTTATTTGACTACTCGAGTAGTCAAATAAGAACCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005906.3-1169s1c1
Sequence:CCGGCCATCTTTAGTTGAGGTAGAGCTCGAGCTCTACCTCAACTAAAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)