EMAIL THIS PAGE TO A FRIEND

MAL2

mal, T-cell differentiation protein 2 (gene/pseudogene)

193 Gene Product Result for
UniProtKB ID: Q969L2, B2R520, Q6ZMD9
Gene ID:
Human(114569) Summary: This gene encodes a multispan transmembrane protein belonging to the MAL proteolipid family. The protein is a component of lipid rafts and, in polarized cells, it primarily localizes to endosomal structures beneath the apical membrane. It is required for transcytosis, an intracellular transport pathway used to deliver membrane-bound proteins and exogenous cargos from the basolateral to the apical surface. [provided by RefSeq, Jul 2008]
Mouse(105853) mal, T cell differentiation protein 2
Rat(362911) mal, T-cell differentiation protein 2
sheep(101120090) mal, T-cell differentiation protein 2
domestic guinea pig(100722785) mal, T-cell differentiation protein 2
naked mole-rat(101710210) mal, T-cell differentiation protein 2
chicken(420280) mal, T-cell differentiation protein 2
cow(511940) mal, T-cell differentiation protein 2
domestic cat(101081865) mal, T-cell differentiation protein 2
dog(608995) mal, T-cell differentiation protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052886 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052886 Rosetta Predictions human pricing
NM_198786 Rosetta Predictions rat pricing
NM_178920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246360 predicted 587
2 SASI_Hs01_00246358 predicted 483
3 SASI_Hs01_00246362 predicted 683
4 SASI_Hs01_00246363 predicted 560
5 SASI_Hs01_00246364 predicted 297
6 SASI_Hs01_00246365 predicted 643
7 SASI_Hs01_00246366 predicted 518
8 SASI_Hs02_00361597 predicted 630
9 SASI_Hs02_00361598 predicted 751
10 SASI_Hs02_00361599 predicted 686
11 SASI_Hs01_00246357 predicted 462
12 SASI_Hs01_00246359 predicted 653
13 SASI_Hs01_00246361 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270060 predicted 631
2 SASI_Rn01_00063901 predicted 623
3 SASI_Rn01_00063902 predicted 484
4 SASI_Rn02_00270061 predicted 469
5 SASI_Rn01_00063903 predicted 756
6 SASI_Rn01_00063904 predicted 638
7 SASI_Rn02_00270062 predicted 355
8 SASI_Rn01_00063905 predicted 698
9 SASI_Rn02_00270063 predicted 701
10 SASI_Rn01_00063906 predicted 736
11 SASI_Rn01_00063907 predicted 416
12 SASI_Rn01_00063908 predicted 813
13 SASI_Rn01_00063909 predicted 410
14 SASI_Rn01_00063910 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053430 predicted 561
2 SASI_Mm01_00053431 predicted 414
3 SASI_Mm01_00053432 predicted 421
4 SASI_Mm01_00053433 predicted 352
5 SASI_Mm01_00053434 predicted 407
6 SASI_Mm01_00053435 predicted 496
7 SASI_Mm01_00053436 predicted 573
8 SASI_Mm01_00053437 predicted 605
9 SASI_Mm01_00053438 predicted 269
10 SASI_Mm01_00053439 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178920
VALIDATED
MAL2 MISSION shRNA Bacterial Glycerol Stock
mal, T-cell differentiation protein 2 (gene/pseudogene)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178920.3-500s21c1
Sequence:CCGGCAGCTTGTTATGGTTGCAGTTCTCGAGAACTGCAACCATAACAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178920.3-352s21c1
Sequence:CCGGGTCTTCTACTTCGGAGCGTTTCTCGAGAAACGCTCCGAAGTAGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178920.3-447s21c1
Sequence:CCGGCGACAACCAGTATAACATCAACTCGAGTTGATGTTATACTGGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178920.3-1619s21c1
Sequence:CCGGGCTGAATTTGAGTAACAGATTCTCGAGAATCTGTTACTCAAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178920.2-1620s1c1
Sequence:CCGGGCTGAATTTGAGTAACAGATTCTCGAGAATCTGTTACTCAAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178920.2-448s1c1
Sequence:CCGGCGACAACCAGTATAACATCAACTCGAGTTGATGTTATACTGGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178920.2-445s1c1
Sequence:CCGGCAACGACAACCAGTATAACATCTCGAGATGTTATACTGGTTGTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178920.2-501s1c1
Sequence:CCGGCAGCTTGTTATGGTTGCAGTTCTCGAGAACTGCAACCATAACAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178920.2-353s1c1
Sequence:CCGGGTCTTCTACTTCGGAGCGTTTCTCGAGAAACGCTCCGAAGTAGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178920
VALIDATED
MAL2 MISSION shRNA shRNA Plasmid DNA
mal, T-cell differentiation protein 2 (gene/pseudogene)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178920.3-500s21c1
Sequence:CCGGCAGCTTGTTATGGTTGCAGTTCTCGAGAACTGCAACCATAACAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178920.3-352s21c1
Sequence:CCGGGTCTTCTACTTCGGAGCGTTTCTCGAGAAACGCTCCGAAGTAGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178920.3-447s21c1
Sequence:CCGGCGACAACCAGTATAACATCAACTCGAGTTGATGTTATACTGGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178920.3-1619s21c1
Sequence:CCGGGCTGAATTTGAGTAACAGATTCTCGAGAATCTGTTACTCAAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178920.2-1620s1c1
Sequence:CCGGGCTGAATTTGAGTAACAGATTCTCGAGAATCTGTTACTCAAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178920.2-448s1c1
Sequence:CCGGCGACAACCAGTATAACATCAACTCGAGTTGATGTTATACTGGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178920.2-445s1c1
Sequence:CCGGCAACGACAACCAGTATAACATCTCGAGATGTTATACTGGTTGTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178920.2-501s1c1
Sequence:CCGGCAGCTTGTTATGGTTGCAGTTCTCGAGAACTGCAACCATAACAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178920.2-353s1c1
Sequence:CCGGGTCTTCTACTTCGGAGCGTTTCTCGAGAAACGCTCCGAAGTAGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178920
VALIDATED
MAL2 MISSION shRNA Lentiviral Transduction Particles
mal, T-cell differentiation protein 2 (gene/pseudogene)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178920.3-500s21c1
Sequence:CCGGCAGCTTGTTATGGTTGCAGTTCTCGAGAACTGCAACCATAACAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178920.3-352s21c1
Sequence:CCGGGTCTTCTACTTCGGAGCGTTTCTCGAGAAACGCTCCGAAGTAGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178920.3-447s21c1
Sequence:CCGGCGACAACCAGTATAACATCAACTCGAGTTGATGTTATACTGGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178920.3-1619s21c1
Sequence:CCGGGCTGAATTTGAGTAACAGATTCTCGAGAATCTGTTACTCAAATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178920.2-1620s1c1
Sequence:CCGGGCTGAATTTGAGTAACAGATTCTCGAGAATCTGTTACTCAAATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178920.2-448s1c1
Sequence:CCGGCGACAACCAGTATAACATCAACTCGAGTTGATGTTATACTGGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178920.2-445s1c1
Sequence:CCGGCAACGACAACCAGTATAACATCTCGAGATGTTATACTGGTTGTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178920.2-501s1c1
Sequence:CCGGCAGCTTGTTATGGTTGCAGTTCTCGAGAACTGCAACCATAACAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178920.2-353s1c1
Sequence:CCGGGTCTTCTACTTCGGAGCGTTTCTCGAGAAACGCTCCGAAGTAGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052886
MAL2 MISSION shRNA Bacterial Glycerol Stock
mal, T-cell differentiation protein 2 (gene/pseudogene)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052886.2-1029s1c1
Sequence:CCGGCTTCCCACTAAACTCTATATTCTCGAGAATATAGAGTTTAGTGGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.2-627s1c1
Sequence:CCGGACCGTAACACTCCTTAGAAACCTCGAGGTTTCTAAGGAGTGTTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052886.1-2045s1c1
Sequence:CCGGGCCCTTTACTTTCTGGCTGAACTCGAGTTCAGCCAGAAAGTAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-555s1c1
Sequence:CCGGCGACAGCTTGTTATGGTTGCACTCGAGTGCAACCATAACAAGCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.1-366s1c1
Sequence:CCGGCTAACTGGAACTTCCTGGATTCTCGAGAATCCAGGAAGTTCCAGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-547s1c1
Sequence:CCGGCTTTATGACGACAGCTTGTTACTCGAGTAACAAGCTGTCGTCATAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.1-254s1c1
Sequence:CCGGGTTCCTCTACCTCTACTACAACTCGAGTTGTAGTAGAGGTAGAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-454s1c1
Sequence:CCGGCCTGCATGATTTGCATTGCAACTCGAGTTGCAATGCAAATCATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-520s1c1
Sequence:CCGGCATAAACGTAGCAGCCTCAATCTCGAGATTGAGGCTGCTACGTTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.1-497s1c1
Sequence:CCGGCTCCTGAGTGATAACCAGTATCTCGAGATACTGGTTATCACTCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052886
MAL2 MISSION shRNA shRNA Plasmid DNA
mal, T-cell differentiation protein 2 (gene/pseudogene)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052886.2-1029s1c1
Sequence:CCGGCTTCCCACTAAACTCTATATTCTCGAGAATATAGAGTTTAGTGGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.2-627s1c1
Sequence:CCGGACCGTAACACTCCTTAGAAACCTCGAGGTTTCTAAGGAGTGTTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052886.1-2045s1c1
Sequence:CCGGGCCCTTTACTTTCTGGCTGAACTCGAGTTCAGCCAGAAAGTAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-555s1c1
Sequence:CCGGCGACAGCTTGTTATGGTTGCACTCGAGTGCAACCATAACAAGCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.1-366s1c1
Sequence:CCGGCTAACTGGAACTTCCTGGATTCTCGAGAATCCAGGAAGTTCCAGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-547s1c1
Sequence:CCGGCTTTATGACGACAGCTTGTTACTCGAGTAACAAGCTGTCGTCATAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.1-254s1c1
Sequence:CCGGGTTCCTCTACCTCTACTACAACTCGAGTTGTAGTAGAGGTAGAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-454s1c1
Sequence:CCGGCCTGCATGATTTGCATTGCAACTCGAGTTGCAATGCAAATCATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-520s1c1
Sequence:CCGGCATAAACGTAGCAGCCTCAATCTCGAGATTGAGGCTGCTACGTTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.1-497s1c1
Sequence:CCGGCTCCTGAGTGATAACCAGTATCTCGAGATACTGGTTATCACTCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052886
MAL2 MISSION shRNA Lentiviral Transduction Particles
mal, T-cell differentiation protein 2 (gene/pseudogene)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052886.2-1029s1c1
Sequence:CCGGCTTCCCACTAAACTCTATATTCTCGAGAATATAGAGTTTAGTGGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.2-627s1c1
Sequence:CCGGACCGTAACACTCCTTAGAAACCTCGAGGTTTCTAAGGAGTGTTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052886.1-2045s1c1
Sequence:CCGGGCCCTTTACTTTCTGGCTGAACTCGAGTTCAGCCAGAAAGTAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-555s1c1
Sequence:CCGGCGACAGCTTGTTATGGTTGCACTCGAGTGCAACCATAACAAGCTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.1-366s1c1
Sequence:CCGGCTAACTGGAACTTCCTGGATTCTCGAGAATCCAGGAAGTTCCAGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-547s1c1
Sequence:CCGGCTTTATGACGACAGCTTGTTACTCGAGTAACAAGCTGTCGTCATAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.1-254s1c1
Sequence:CCGGGTTCCTCTACCTCTACTACAACTCGAGTTGTAGTAGAGGTAGAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-454s1c1
Sequence:CCGGCCTGCATGATTTGCATTGCAACTCGAGTTGCAATGCAAATCATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052886.1-520s1c1
Sequence:CCGGCATAAACGTAGCAGCCTCAATCTCGAGATTGAGGCTGCTACGTTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052886.1-497s1c1
Sequence:CCGGCTCCTGAGTGATAACCAGTATCTCGAGATACTGGTTATCACTCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)