EMAIL THIS PAGE TO A FRIEND

MAL

mal, T-cell differentiation protein

96 Gene Product Result for
UniProtKB ID: P21145, Q6FH77
Gene ID:
Human(4118) Summary: The protein encoded by this gene is a highly hydrophobic integral membrane protein belonging to the MAL family of proteolipids. The protein has been localized to the endoplasmic reticulum of T-cells and is a candidate linker protein in T-cell signal transduction. In addition, this proteolipid is localized in compact myelin of cells in the nervous system and has been implicated in myelin biogenesis and/or function. The protein plays a role in the formation, stabilization and maintenance of glycosphingolipid-enriched membrane microdomains. Down-regulation of this gene has been associated with a variety of human epithelial malignancies. Alternative splicing produces four transcript variants which vary from each other by the presence or absence of alternatively spliced exons 2 and 3. [provided by RefSeq, May 2012]
Mouse(17153) myelin and lymphocyte protein, T cell differentiation protein
Rat(25263) mal, T-cell differentiation protein
naked mole-rat(101696352) mal, T-cell differentiation protein
domestic guinea pig(100715705) mal, T-cell differentiation protein
Zebrafish(550381) mal, T-cell differentiation protein
fruit fly(5656947) Malformed
cow(510077) mal, T-cell differentiation protein
domestic cat(101085795) mal, T-cell differentiation protein
dog(403933) mal, T-cell differentiation protein
fruit fly(33045) maroon-like
chicken(416707) mal, T-cell differentiation protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086601 MISSION® esiRNA esiRNA human MAL (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MABF167A Anti-CD8 (human), FITC, clone SK1 Antibody Anti-CD8 (human), FITC, clone SK1 Antibody is an antibody against CD8 (human), FITC, clone SK1 for use in Flow Cytometry. pricing
MABF167C Anti-CD8 (human), PE, clone SK1 Antibody This Anti-CD8 (human), PE, clone SK1 Antibody is validated for use in Flow Cytometry for the detection of CD8. pricing
MABF168C Anti-CD8 (human), PerCP, clone SK1 Antibody Anti-CD8 (human), PerCP, clone SK1 Antibody is an antibody against CD8 for use in Flow Cytometry. pricing
MABF169A Anti-CD8 (human), violetFluor™ 450, clone SK1 Antibody This mouse monoclonal Anti-CD8 Antibody (human), violetFluor™ 450, clone SK1, Cat. No. MABF1690 is validated for use in Flow Cytometry, for the detection of CD8. pricing
MABF916 Anti-CD8a (human) Antibody, AlexaFluor®488, clone HIT8a Detect CD8 using this mouse monoclonal antibody, Anti-CD8a (human) Antibody, AlexaFluor®488, clone HIT8a validated for use in Flow Cytometry & IHC. pricing
MABF327 Anti-CD8a (human) Antibody, PE, clone HIT8a Anti-CD8a (human) Antibody, PE, clone HIT8a is a highly specific mouse monoclonal antibody, that targets CD8 & has been tested in Flow Cytometry & IHC. pricing
MABF167B Anti-CD8a (human), FITC, clone RPA-T8 Antibody Anti-CD8a (human), FITC, clone RPA-T8 Antibody is an antibody against CD8a (human), FITC, clone RPA-T8 for use in Flow Cytometry. pricing
MABF167D Anti-CD8a (human), PE, clone RPA-T8 Antibody This Anti-CD8a (human), PE, clone RPA-T8 Antibody is validated for use in Flow Cytometry for the detection of CD8a. pricing
MABF169C Anti-CD8a (human), redFluor™ 710, clone RPA-T8 Antibody This mouse monoclonal Anti-CD8a Antibody (human), redFluor™ 710, clone RPA-T8, Cat. No. MABF1695 is validated for use in Flow Cytometry, for the detection of CD8a. pricing
MABF169B Anti-CD8a (human), violetFluor™ 450, clone RPA-T8 Antibody This mouse monoclonal Anti-CD8a Antibody (human), violetFluor™ 450, clone RPA-T8, Cat. No. MABF1693 is validated for use in Flow Cytometry, for the detection of CD8a. pricing
ABF211 Anti-Tirap Antibody Detect Toll/interleukin-1 receptor domain-containing adapter protein using this rabbit polyclonal antibody, Anti-Tirap Antibody validated for use in western blotting, IHC & Immunofluorescence. pricing
FCMAB427F Milli-Mark® Anti-mouse CD8-FITC Antibody, clone 3.155 Detect mouse CD8 using this Milli-Mark Anti-mouse CD8-FITC Antibody, clone 3.155 validated for use in FC. pricing
FCMAB428PE Milli-Mark® Anti-mouse CD8-PE Antibody, clone 3.155 Milli-Mark Anti-mouse CD8-PE Antibody, clone 3.155 is an antibody against mouse CD8 for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002371 Rosetta Predictions human pricing
NM_022438 Rosetta Predictions human pricing
NM_022439 Rosetta Predictions human pricing
NM_022440 Rosetta Predictions human pricing
NM_012798 Rosetta Predictions rat pricing
NM_010762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017964 predicted 257
2 SASI_Hs01_00017965 predicted 253
3 SASI_Hs01_00017966 predicted 402
4 SASI_Hs01_00017967 predicted 330
5 SASI_Hs02_00333706 predicted 374
6 SASI_Hs01_00017968 predicted 256
7 SASI_Hs01_00017969 predicted 252
8 SASI_Hs01_00017970 predicted 297
9 SASI_Hs01_00017971 predicted 381
10 SASI_Hs01_00017972 predicted 206
11 SASI_Hs01_00017973 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034109 predicted 249
2 SASI_Hs01_00034110 predicted 880
3 SASI_Hs01_00034111 predicted 753
4 SASI_Hs01_00034113 predicted 634
5 SASI_Hs02_00355690 predicted 260
6 SASI_Hs01_00034115 predicted 820
7 SASI_Hs01_00034116 predicted 295
8 SASI_Hs01_00034117 predicted 346
9 SASI_Hs01_00034118 predicted 894
10 SASI_Hs02_00355691 predicted 742
11 SASI_Hs01_00034112 predicted 364
12 SASI_Hs01_00034114 predicted 125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071173 predicted 837
2 SASI_Hs01_00071174 predicted 236
3 SASI_Hs01_00071175 predicted 715
4 SASI_Hs01_00071176 predicted 312
5 SASI_Hs01_00071177 predicted 599
6 SASI_Hs01_00071179 predicted 784
7 SASI_Hs01_00071180 predicted 305
8 SASI_Hs01_00071181 predicted 852
9 SASI_Hs01_00071182 predicted 210
10 SASI_Hs02_00355692 predicted 780
11 SASI_Hs01_00071178 predicted 128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048270 predicted 705
2 SASI_Hs01_00048272 predicted 590
3 SASI_Hs01_00048273 predicted 189
4 SASI_Hs02_00355693 predicted 703
5 SASI_Hs01_00048274 predicted 471
6 SASI_Hs01_00048275 predicted 123
7 SASI_Hs01_00048276 predicted 660
8 SASI_Hs01_00048277 predicted 179
9 SASI_Hs01_00048278 predicted 724
10 SASI_Hs01_00048279 predicted 659
11 SASI_Hs01_00048271 predicted 143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043917 predicted 980
2 SASI_Rn01_00043918 predicted 952
3 SASI_Rn01_00043919 predicted 278
4 SASI_Rn01_00043920 predicted 230
5 SASI_Rn01_00043921 predicted 553
6 SASI_Rn01_00043922 predicted 812
7 SASI_Rn01_00043923 predicted 965
8 SASI_Rn01_00043924 predicted 725
9 SASI_Rn01_00043925 predicted 558
10 SASI_Rn01_00043926 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155837 predicted 757
2 SASI_Mm01_00155838 predicted 837
3 SASI_Mm01_00155839 predicted 759
4 SASI_Mm01_00155840 predicted 1418
5 SASI_Mm02_00319295 predicted 628
6 SASI_Mm01_00155841 predicted 881
7 SASI_Mm01_00155843 predicted 1501
8 SASI_Mm01_00155844 predicted 1366
9 SASI_Mm01_00155845 predicted 816
10 SASI_Mm02_00319296 predicted 1424
11 SASI_Mm01_00155836 predicted 419
12 SASI_Mm01_00155842 predicted 1107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002371
MAL MISSION shRNA Bacterial Glycerol Stock
mal, T-cell differentiation protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002371.2-526s1c1
Sequence:CCGGGCAGTAGAACTTGAGCTGAAACTCGAGTTTCAGCTCAAGTTCTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-261s1c1
Sequence:CCGGACCTTGATCATCCTGTACATACTCGAGTATGTACAGGATGATCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-487s1c1
Sequence:CCGGCGGTGTTCTCTTTAATCAGATCTCGAGATCTGATTAAAGAGAACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-482s1c1
Sequence:CCGGCCATGCGGTGTTCTCTTTAATCTCGAGATTAAAGAGAACACCGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-126s1c1
Sequence:CCGGCCCGACTTGCTCTTCATCTTTCTCGAGAAAGATGAAGAGCAAGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002371.2-391s21c1
Sequence:CCGGTCACGATGCAAGACGGCTTCACTCGAGTGAAGCCGTCTTGCATCGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002371.2-571s21c1
Sequence:CCGGCCCACTTTCCGGCATAACTTTCTCGAGAAAGTTATGCCGGAAAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002371.2-762s21c1
Sequence:CCGGTGCTAGGGTCACCTCCTGTTTCTCGAGAAACAGGAGGTGACCCTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002371
MAL MISSION shRNA shRNA Plasmid DNA
mal, T-cell differentiation protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002371.2-526s1c1
Sequence:CCGGGCAGTAGAACTTGAGCTGAAACTCGAGTTTCAGCTCAAGTTCTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-261s1c1
Sequence:CCGGACCTTGATCATCCTGTACATACTCGAGTATGTACAGGATGATCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-487s1c1
Sequence:CCGGCGGTGTTCTCTTTAATCAGATCTCGAGATCTGATTAAAGAGAACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-482s1c1
Sequence:CCGGCCATGCGGTGTTCTCTTTAATCTCGAGATTAAAGAGAACACCGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-126s1c1
Sequence:CCGGCCCGACTTGCTCTTCATCTTTCTCGAGAAAGATGAAGAGCAAGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002371.2-391s21c1
Sequence:CCGGTCACGATGCAAGACGGCTTCACTCGAGTGAAGCCGTCTTGCATCGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002371.2-571s21c1
Sequence:CCGGCCCACTTTCCGGCATAACTTTCTCGAGAAAGTTATGCCGGAAAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002371.2-762s21c1
Sequence:CCGGTGCTAGGGTCACCTCCTGTTTCTCGAGAAACAGGAGGTGACCCTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002371
MAL MISSION shRNA Lentiviral Transduction Particles
mal, T-cell differentiation protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002371.2-526s1c1
Sequence:CCGGGCAGTAGAACTTGAGCTGAAACTCGAGTTTCAGCTCAAGTTCTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-261s1c1
Sequence:CCGGACCTTGATCATCCTGTACATACTCGAGTATGTACAGGATGATCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-487s1c1
Sequence:CCGGCGGTGTTCTCTTTAATCAGATCTCGAGATCTGATTAAAGAGAACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-482s1c1
Sequence:CCGGCCATGCGGTGTTCTCTTTAATCTCGAGATTAAAGAGAACACCGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002371.2-126s1c1
Sequence:CCGGCCCGACTTGCTCTTCATCTTTCTCGAGAAAGATGAAGAGCAAGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002371.2-391s21c1
Sequence:CCGGTCACGATGCAAGACGGCTTCACTCGAGTGAAGCCGTCTTGCATCGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002371.2-571s21c1
Sequence:CCGGCCCACTTTCCGGCATAACTTTCTCGAGAAAGTTATGCCGGAAAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002371.2-762s21c1
Sequence:CCGGTGCTAGGGTCACCTCCTGTTTCTCGAGAAACAGGAGGTGACCCTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010762
MAL MISSION shRNA Bacterial Glycerol Stock
mal, T-cell differentiation protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010762.2-1103s1c1
Sequence:CCGGGCTCCTTTGAAATGCTTCATTCTCGAGAATGAAGCATTTCAAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-474s1c1
Sequence:CCGGGCCACCATCTCAATGTTTGATCTCGAGATCAAACATTGAGATGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-586s1c1
Sequence:CCGGCCTTAATCAGATGGAAGTCTTCTCGAGAAGACTTCCATCTGATTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-353s1c1
Sequence:CCGGCCTGATGATCTTGTACATAATCTCGAGATTATGTACAAGATCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-484s1c1
Sequence:CCGGCAATGTTTGATGGCTTTACTTCTCGAGAAGTAAAGCCATCAAACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010762
MAL MISSION shRNA shRNA Plasmid DNA
mal, T-cell differentiation protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010762.2-1103s1c1
Sequence:CCGGGCTCCTTTGAAATGCTTCATTCTCGAGAATGAAGCATTTCAAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-474s1c1
Sequence:CCGGGCCACCATCTCAATGTTTGATCTCGAGATCAAACATTGAGATGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-586s1c1
Sequence:CCGGCCTTAATCAGATGGAAGTCTTCTCGAGAAGACTTCCATCTGATTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-353s1c1
Sequence:CCGGCCTGATGATCTTGTACATAATCTCGAGATTATGTACAAGATCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-484s1c1
Sequence:CCGGCAATGTTTGATGGCTTTACTTCTCGAGAAGTAAAGCCATCAAACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010762
MAL MISSION shRNA Lentiviral Transduction Particles
mal, T-cell differentiation protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010762.2-1103s1c1
Sequence:CCGGGCTCCTTTGAAATGCTTCATTCTCGAGAATGAAGCATTTCAAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-474s1c1
Sequence:CCGGGCCACCATCTCAATGTTTGATCTCGAGATCAAACATTGAGATGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-586s1c1
Sequence:CCGGCCTTAATCAGATGGAAGTCTTCTCGAGAAGACTTCCATCTGATTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-353s1c1
Sequence:CCGGCCTGATGATCTTGTACATAATCTCGAGATTATGTACAAGATCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010762.2-484s1c1
Sequence:CCGGCAATGTTTGATGGCTTTACTTCTCGAGAAGTAAAGCCATCAAACATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)